Cancer Patent

February 2, 2009

Multi-marker RT-PCR panel for detecting metastatic breast cancer

Filed under: Issued Patent — admin @ 3:29 am

Abstract
A method of detecting the metastasis of primary breast cancer to a lymph node is provided, comprising detecting, in lymph node tissue, the presence of a nucleic acid of c-myc, PIP or keratin-19. The presence of any one of these nucleic acids in lymph node tissue is associated with metastatic breast cancer. The presence of one or more of these markers in lymph node tissue or other tissue indicates that cells from the primary tumor have migrated from the breast tissue to the lymph node or other tissue. Also provided is a method of predicting the histopathologic stage of a cancer in a patient without having to perform a histopathologic analysis, comprising detecting, in lymph node tissue from the patient, the presence of a nucleic acid of c-myc, the presence of a nucleic acid of c-myc being correlated with stage I cancer as determined by histopathology. Alternatively, the absence of a nucleic acid of PIP and the absence of a nucleic acid of keratin-19 are correlated with stage I cancer as determined by histopathology. In another embodiment, the presence of a nucleic acid of PIP is correlated with stages later than stage I cancer as determined by histopathology. Further, the presence of a nucleic acid of keratin-19 is correlated with stages later than stage I cancer as determined by histopathology. A method of predicting survival time of cancer patients is also provided, comprising detecting, in lymph node tissue from the patient, the presence of a nucleic acid of c-myc, PIP or keratin-19. The presence of a nucleic acid of any of c-myc, PIP or keratin-19 is correlated with a shorter average survival time compared with the presence of none of the nucleic acids.

——————————————————————————–
Inventors: Cole; David J. (Mt. Pleasant, SC), Baron; Paul L. (Charleston, SC), O’Brien; Paul H. (Charleston, SC)
Assignee: Medical University of South Carolina (SC)

Appl. No.: 09/086,372
Filed: May 28, 1998

Claims

——————————————————————————–

What is claimed is:

1. A method of detecting the metastasis of primary breast cancer to a lymph node, comprising detecting, in lymph node tissue, the presence of a nucleic acid of c-myc, PIP, a combination of c-myc and keratin-19, a combination of c-myc and PIP, a combination of c-myc, keratin-19 and PIP or a combination of PIP and keratin-19, the presence of any of these nucleic acids or combinations of nucleic acids in lymph node tissue being associated with metastatic cancer.

2. The method of claim 1, wherein the lymph node tissue is from the sentinel lymph node.

3. A method of determining the lower likelihood of survival to five years of a cancer patient, comprising detecting, in lymph node tissue from the patient, the presence of the nucleic acids of two or more of c-myc, PIP or keratin-19, the presence of two or more of c-myc, PIP or keratin-19, being correlated with a lower likelihood of survival to five years compared to the likelihood of survival to five years of a cancer patient having only c-myc in lymph node tissue.

4. The method of claim 3, wherein the lymph node tissue is from the sentinel lymph node.

5. A method of identifying a cancer patient as likely to have stage I cancer as determined by AJCC staging criteria, comprising detecting, in lymph node tissue from the patient, the absence of a nucleic acid of PIP, the absence of a nucleic acid of keratin-19 and the presence of a nucleic acid of c-myc, the absence of a nucleic acid of PIP, the absence of a nucleic acid of keratin-19 and the presence of a nucleic acid of c-myc being correlated with stage I cancer as determined by AJCC staging criteria.

6. The method of claim 5, wherein the lymph node tissue is from the sentinel lymph node.

7. A method of identifying a cancer patient as likely to have a stage of cancer later than stage I as determined by AJCC staging criteria, comprising detecting, in lymph node tissue from the patient, the presence of a nucleic acid of PIP, the presence of a nucleic acid of PIP being correlated with stages later than stage I cancer as determined by AJCC criteria.

8. The method of claim 7, wherein the lymph node tissue is from the sentinel lymph node.

9. A method of identifying a cancer patient as likely to have a stage of cancer later than stage I as determined by AJCC criteria, comprising detecting, in lymph node tissue from the patient, the presence of a nucleic acid of keratin-19, the presence of a nucleic acid of keratin-19 being correlated with stages later than stage I cancer as determined by AJCC criteria.

10. The method of claim 9, wherein the lymph node tissue is from the sentinel lymph node.
——————————————————————————–

Description

——————————————————————————–

BACKGROUND OF THE INVENTION

1. Field of the Invention

The invention relates to the use of multiple markers, detected using RT-PCR to detect metastasis of breast cancer. The invention further relates to the use of multiple markers to determine cancer staging and prognosis.

2. Background Art

Breast cancer remains a leading cause of cancer death among American women [1]. When staging a patient with breast cancer, lymph node status continues to be the most valuable predictor of prognosis. An inverse relationship exists between the number of lymph nodes positive for cancer and the patient’s survival [1,2]. The standard method for evaluating the lymph nodes of patients with breast cancer is histologic analysis of hematoxylin and eosin stained sections from axillary lymph nodes within the ipsilateral lymph node basin. Axillary lymph node (ALN) status in breast cancer patients remains the single most important predictor of outcome. However, as many as 30% of patients with pathologically negative lymph nodes ultimately develop recurrent cancer, suggesting that current methods are inadequate for identifying micrometastatic disease [3].

Serial sectioning of these nodes combined with the use of immunohistochemical stains can demonstrate micrometastases in up to 25% of nodes which were “negative” during the routine histopathologic examination process [4,5]. Furthermore, it has been suggested retrospectively that these patients with occult micrometastatic disease have a poorer prognosis [5]. Despite the valuable information it provides, serial sectioning and staining is too cumbersome and costly to be performed as a routine.

Given the significant incidence of missed metastases by routine pathology (and current 30% recurrence rate in node-negative breast cancer patients) a more sensitive method of detecting metastases would be of clear benefit to the clinician making treatment decisions. The present RT-PCR technology applied as a multimarker screening panel is significantly more sensitive and cost-effective method to detect occult axillary lymph node micrometastases in breast cancer patients.

SUMMARY OF THE INVENTION

A novel method of detecting the metastasis of primary breast cancer to a lymph node is provided, comprising detecting, in lymph node tissue, the presence of a nucleic acid associated with breast cancer. The novel method of detecting the metastasis of primary breast cancer to a lymph node can comprise detecting, in lymph node tissue, the presence of a nucleic acid of c-myc, PIP or keratin-19. The presence of any one of these nucleic acids in lymph node tissue is associated with metastatic breast cancer. The presence of one or more of these markers in lymph node tissue or other tissue indicates that cells from the primary tumor have migrated from the breast tissue to the lymph node or other tissue.

Also provided is a method of predicting the histopathologic stage of a cancer in a patient without having to perform a histopathologic analysis. This method is feasible, because the data provided in the Examples correlates the presence of certain markers with certain stages of cancer as determined independently by histopathology. In one embodiment, this method comprises detecting, in lymph node tissue from the patient, the presence of a nucleic acid of c-myc, the presence of a nucleic acid of c-myc being correlated with stage I cancer as determined by histopathology. In a further embodiment, this method comprises determining, in lymph node tissue from the patient, the absence of a nucleic acid of PIP and the absence of a nucleic acid of keratin-19, the absence of nucleic acids of PIP and keratin-19 being correlated with stage I cancer as determined by histopathology. In another embodiment, this method comprises detecting, in lymph node tissue from the patient, the presence of a nucleic acid of PIP, the presence of PIP being correlated with stages later than stage I cancer as determined by histopathology. An additional embodiment of this method comprises detecting, in lymph node tissue from the patient, the presence of a nucleic acid of keratin-19, the presence of keratin-19 being correlated with stages later than stage I cancer as determined by histopathology.

A method of predicting survival time of cancer patients is also provided, comprising detecting, in lymph node tissue from the patient, the presence of a nucleic acid of c-myc, PIP or keratin-19. The presence of a nucleic acid of any of c-myc, PIP or keratin-19 is correlated with a shorter average survival time compared with the presence of none of the nucleic acids. The presence of nucleic acids of two or more of c-myc, PIP or keratin-19 is correlated with a shorter average survival time compared with the presence of only one of the nucleic acids. The presence of nucleic acids of all three of c-myc, PIP and keratin-19 is correlated with a shorter average survival time compared with the presence of only one or two of the nucleic acids.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A, 1B, 1C and 1D show RT-PCR detection of tumor-associated genes in the MB-175 IV breast cancer cell line (FIG. 1A), MDA-MB-231 breast cancer cell line (FIG. 1B), no template negative control (FIG. 1C), and normal cervical lymph node (FIG. 1D). The first lane for each condition is a 100 bp size marker ladder with gene specific primer pairs utilized in the following lanes as follows: 1) .beta.-actin, 2) keratin, 3) c-myc, 4) no primer negative control, 5) PIP. The breast cancer cell line MDA-231 exhibited bands of appropriate size for beta actin, keratin-19, and c-myc; while the cell line MB-175 exhibited .beta.-actin, keratin-19, and PIP. Normal cervical lymph node was only positive for the .beta.-actin internal control.

FIG. 2 is a comparison of clinical staging of disease by routine histopathology versus multimarker RT-PCR screening. Diagonal cross-hatching=clinical staging based on routine histopathologic findings. .box-solid.=RT-PCR modified clinical staging, with RT-PCR positivity used to define an N1 lymph node.

FIG. 3 shows an analysis of the relationship between the number of positive RT-PCR markers and severity of disease based on 5 year predicted survival. The mean number of RT-PCR markers positive per clinical stage upon presentation was calculated using routine histopathology findings to determine N status. Using the AJCC 5 year predicted survival per stage at presentation, a linear regression analysis was performed comparing predicted survival to number of markers positive. The mean number of markers positive is noted on the Y-axis (with standard error and stage of disease noted for each point). The percent survival predicted at five years per stage of disease is plotted along the X-axis. A correlation is noted between the number of positive markers by RT-PCR and predicted survival per stage (r=0.950, p<0.002).

DETAILED DESCRIPTION OF THE INVENTION

As used in the specification and in the claims, “a” can mean one or more, depending upon the context in which it is used.

A novel method of detecting the metastasis of primary breast cancer to a lymph node is provided, comprising detecting, in lymph node tissue, the presence of a nucleic acid associated with breast cancer. The novel method of detecting the metastasis of primary breast cancer to a lymph node can comprise detecting, in lymph node tissue, the presence of a nucleic acid of c-myc, PIP or keratin-19. The presence of one or more of these markers in lymph node tissue or other tissue indicates that cells from the primary tumor have migrated from the breast tissue to the lymph node or other tissue. Thus, these nucleic acids are markers for metastasis wherever they are found outside of the primary tumor. Other markers now known or later found to be associated with breast cancer can also be the focus of the present method to detect metastasis.

The nucleic acid being detected is specific for c-myc (Colby et al. (29)), PIP (Shiu et al. (21)) or keratin-19 (Noguchi et al. (14)). Thus, the probes or primers used to detect the nucleic acids can be any nucleic acid that is specific for the particular marker. Alternatively, any nucleic acid that is specific for two or all three of these markers can also be used as the primer of probe in the present method. As used herein to describe a nucleic acid, “specific” means that the nucleotide sequence of the nucleic acid is not found identically in any source other than the stated source. The determination of specificity is made routine, because of the availability of computerized nucleotide sequence databases, wherein an nucleotide sequence of almost any length can be quickly and reliably checked for the existence of identical sequences. If an identical sequence is not found, the nucleic acid is “specific” for the recited source. If the primer or probe used is not specific for c-myc, PIP or keratin-19, a further step of identification must be carried out to establish the presence of one of these markers in the lymph node tissue. Such a step is within the scope of this invention.

The presence of two or more markers in the lymph node or other tissue is more strongly correlated with metastasis than the presence of only one marker. The presence of all three markers is an even stronger indicator that the primary cancer has metastasized. Conversely, if all of the markers are tested for, but none are found, the confidence in the negative findings is stronger than if fewer than all of the markers were tested for.

Having provided a means for staging cancer based on the presence of certain markers, the invention allows for more accurate staging of cancers than current techniques allow. In contrast to the standard method of staging breast cancer, which relies on histopathologic detection of cancer in the lymph nodes (in combination with primary tumor size and the presence or absence of cancer elsewhere in the body), the detection of markers as taught in the present invention is more sensitive, and thus, more accurate. As shown herein, the presence of certain of the markers or combinations of markers is indicative of a later stage of cancer than was determined using the standard, histopathology-based methods. The present RT-PCR methodology may provide valuable prognostic information which would allow the clinician to make more informed adjuvant therapy decisions. Thus, the improved information about the stage of a patient’s cancer provided by the present methods can be used to tailor a treatment regimen to that patient, increasing the likelihood of improved outcome.

The present method can be used to test paraffin embedded tissues by PCR. These tissues may be from patients currently showing no sign of metastasis according to the usual clinical methods. Thus, testing of the paraffin samples of these patients may be used to inform the doctor and patient of undetected metastasis or the likelihood of later relapse. This method also permits the use of PCR to detect metastasis in specimens that are prepared for the standard histopathologic analysis.

A method of predicting survival time of cancer patients is also provided, comprising detecting, in lymph node tissue from the patient, the presence of a nucleic acid associated with breast cancer. The method of predicting survival time of cancer patients can comprise detecting, in lymph node tissue from the patient, the presence of a nucleic acid of c-myc, PIP or keratin-19. The presence of a nucleic acid of any of c-myc, PIP or keratin-19 is correlated with a shorter average survival time compared with the presence of none of the nucleic acids. The presence of nucleic acids of two or more of c-myc, PIP or keratin-19 is correlated with a shorter average survival time compared with the presence of only one of the nucleic acids. The presence of nucleic acids of all three of c-myc, PIP and keratin-19 is correlated with a shorter average predicted survival time compared with the presence of only one or two of the nucleic acids. It is also noted that, if all of the markers are tested for but none are found, the confidence in the prediction of longer survival time is stronger than if fewer than all of the markers were tested for.

In a method of predicting survival time of cancer patients as provided herein, in one embodiment, this method comprises detecting, in lymph node tissue from the patient, the presence of a nucleic acid of c-myc, the presence of a nucleic acid of c-myc being correlated with longer survival time compared to the presence of PIP or keratin-19. In a further embodiment, this method comprises determining, in lymph node tissue from the patient, the absence of a nucleic acid of PIP and the absence of a nucleic acid of keratin-19, the absence of nucleic acids of PIP and keratin-19 being correlated with longer survival time compared to the presence of these nucleic acids. In another embodiment, this method comprises detecting, in lymph node tissue from the patient, the presence of a nucleic acid of PIP, the presence of PIP being correlated with shorter survival time compared to the presence of c-myc. An additional embodiment of this method comprises detecting, in lymph node tissue from the patient, the presence of a nucleic acid of keratin-19, the presence of keratin-19 being correlated with shorter survival time compared to the presence of c-myc.

In each of the methods described herein, the lymph node tissue can be from the sentinel lymph node. Alternatively, it can be from any of the other lymph nodes. In any of the present methods, lymph node tissue from several or all of the patient’s lymph nodes can be tested for the presence or absence of one or more of the described markers.

Furthermore, because the present data show the correlation of the presence of certain markers in non-primary breast tumor tissue with metastasis of the breast cancer, the invention provides a method of detecting metastasis to other tissues. For example, bone marrow (e.g., aspirates), blood, bone and adipose tissue, among others, can be tested for the presence of the markers described herein, as well as for other markers that become associated with breast cancer. Similarly, other nucleic acids that are now known to be associated with breast cancer, or are later found to be associated with breast cancer, can be used in the methods described herein. Examples of these markers are provided below.

There is additional data that supports the use of the present markers to predict disease recurrence. For example, the presence of nucleic acids of one of c-myc, PIP and keratin-19 is correlated with a higher likelihood of recurrence compared with the presence of none of the nucleic acids. The presence of nucleic acids of two or more of c-myc, PIP and keratin-19 is correlated with a higher likelihood of recurrence compared with the presence of only one of the nucleic acids. The presence of nucleic acids of all three of c-myc, PIP and keratin-19 is correlated with a higher likelihood of recurrence compared with the presence of only two of the nucleic acids.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:1 is provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:2 is provided. These are specific for the marker c-myc.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:3 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:4 is also provided. These are specific for the marker PIP.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:5 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:6 is also provided. These are specific for the marker keratin 19.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:7 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:8 is also provided. These are specific for the marker MUC1.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:9 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:10 is also provided. These are specific for the marker OSN.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:11 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:12 is also provided. These are specific for the marker MDR1.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:13 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:14 is also provided. These are specific for the marker DCC.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:15 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:16 is also provided. These are specific for the marker BNSP.

A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:17 is also provided. A nucleic acid consisting of the sequence shown in the Sequence Listing as SEQ ID NO:18 is also provided. These are specific for the marker HER2.

Blotting techniques can be used for detecting the present marker genes. For example, southern blotting is described herein for detecting markers of metastasis in lymph nodes. The probes used in the southern blots can be the primers described herein that have been labeled to facilitate detection of hybrids. An example of this method is described below.

Although specific examples of primers and probes are provided herein, it is understood that other probes and primers that are specific for a given marker (gene) can be routinely obtained and used in the methods taught herein.

The present invention is more particularly described in the following examples which are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.

EXAMPLE 1

Detection of Occult Breast Cancer Micrometastases in Axillary Lymph Nodes

Patients

Sixty one patients undergoing either lumpectomy and axillary dissection or modified radical mastectomy for invasive breast cancer were evaluated. All patients were staged according to AJCC standard criteria by the attending surgeon using relevant clinical data and routine histopathologic analysis of the ipsilateral lymph nodes. Nine patients undergoing carotid endarterectomy without evidence of malignancy were consented for use of their cervical lymph nodes as negative controls.

Axillary Lymph Node Processing

Immediately after resection, the axillary lymph nodes were identified and separated from the specimen by a pathologist. Nodes from levels I, II or III which were greater than 1 cm were bisected, with half of the node sent for routine histologic evaluation and the other half for RT-PCR screening. The cassette used for routine pathologic processing was marked for future identification. The RT-PCR screened lymph nodes were snap frozen in liquid nitrogen immediately to prevent RNA degradation. These were maintained at -70.degree. C. until processed to total RNA was performed. The normal cervical lymph nodes obtained from nine patients undergoing carotid endarterectomy were processed in a similar manner for use as negative controls.

Oligonucleotide Primers

Four specific primer pairs were designed for the following genes: c-myc and PIP (tumor markers expressed in breast cancer specimens), Keratin-19 (an epithelial marker expressed in breast cancer and not in normal lymphatic tissue); and .beta.-actin (used as a positive control, since it is expressed in all tissues). Each gene marker’s DNA sequence was identified using the Genbank computer database and Oligo 5.0 software, or based on verification of prior published sequences [8,13,15,23]. The size of each amplified segment was determined using the DNA Strider software so that actual and predicted band size could be compared. The primers were synthesized on an Expedite Nucleic Acid Synthesis System, model 8909 (Perceptive Biosystems). Primer sequences were: 1) c-myc fwd 5′ ACGCAGCGCCTCCCTCC 3′ (SEQ ID NO:1), 2) c-myc rev 5′ GGAGGGAGGCGCTGCGT 3′ (SEQ ID NO:2), 3) Prolactin inducible protein (PIP) fwd: 5′ GCTCAGGACAACACTCGGAA 3′ (SEQ ID NO:3), 4) PIP rev: 5′ ATAACATCAACGACGGCTGC 3′ (SEQ ID NO:4), 5) Keratin fwd: 5′ GCGGCGCACCCTTCAGG 3′ (SEQ ID NO:5)’, 6) Keratin rev: 5′ CCTGAAGGGTGCGCCGC 3′ (SEQ ID NO:6), 7) B-actin fwd: 5′ GCGGCTACAGCTTCACCACCAC 3′ (SEQ ID NO:19), B-actin rev: 5′ GGAGGGGCCGGACTCGTCATA 3′ (SEQ ID NO:20).

Cell Lines

Breast cancer cell lines MDA-MB-231 and MDA-MB-175-VII (ATCC, Rockville, Md.) were maintained in RPMI (Gibco-BRL, Rockville Md.) supplemented with 10% fetal bovine serum at 37.degree. C. in a tissue incubator. Cells were harvested and counted using a standard hemocytometer.

RNA Isolation and RT-PCR

Total cellular RNA was isolated from breast cancer cell lines, normal lymph nodes, and lymph nodes from patients with breast cancer using the guanidium thiocynate-phenol-chloroform method via the RNA-zol protocol (Tel-Test Inc., Friendswood, Tex.). For each lymph node specimen, approximately 1 gram of snap frozen tissue was collected from portions of the harvested lymph nodes and homogenized using a mechanical tissue homogenizer (Biospec Products, Bartlesville, Okla.). Positive control breast cancer cell lines MDA-MB-231 and MDA-MB-175-VII cells were harvested and counted using a hemocytometer with 5.times.10.sup.6 cells used for each RNA isolation. RNA isolation was then performed per protocol and total RNA yield determined by spectrophotometer. Complimentary DNA was made from 5 .mu.g of total RNA using the Superscript II reverse transcriptase kit (GibcoBRL, Gaithersburg, Md.). Briefly, 5 .mu.g of total RNA was combined with oligo (dT) for 10 min at 70.degree. C.; then 10.times.PCR buffer (4 .mu.l), 25 mM MgCl.sub.2 (4 .mu.l), 10 mM dNTP (2 .mu.l), and 0.1 M DTT (4 .mu.l) were added and the sample was incubated for 5 minutes at 42.degree. C. Next, Superscript II Reverse Transcriptase was added (200 units) and the reaction carried out for 50 minutes. Reactions were terminated at 70.degree. C. for 15 minutes and RNase H (2 units) added, and the specimen was incubated for 20 minutes at 37.degree. C. PCR was then performed using 1 .mu.l of cDNA, 1 .mu.l of each gene-specific primer (25 pM), 4 .mu.l 2.5 mM dNTP, 5 .mu.l 10.times.PCR buffer, 37.8 .mu.l H.sub.2 O, and 0.2 .mu.l TAQ polymerase. PCR reactions were performed for 25 cycles (94.degree. C.–5 minutes, 30 seconds, 55.degree. C.–30 seconds, 72.degree. C.–7 minutes, 30 seconds) on a thermal cycler (Perkin Elmer Genamp 2400, Foster City, Calif.). The PCR product (10 .mu.l) was loaded into a 1% agarose gel containing ethidium bromide and electrophoresis performed. The gel was examined and photographed using an ultraviolet imager.

Pathologic Analysis

The patients axillary lymph node specimens were processed in standard fashion. This resulted in each patient having two slides per processed block examined by the pathologist after hematoxylin and eosin (H&E) staining. Patient axillary lymph node specimens identified as negative by routine H&E histologic evaluation were then further evaluated. Paraffin blocks containing tissue from lymph nodes were identified and re-sectioned for the additional histologic studies. From 1 to 9 paraffin blocks per patient (a total of 136 blocks) were re-sectioned as follows: the block was faced and consecutive sections were then stained using hematoxylin and eosin, and AE1/AE3 (an immunostain cocktail for identification of cytokeratins, Dako, Carpinteria, Calif.). An additional section served as a negative control for this immunostain. The sequence was repeated after having set aside 15 consecutive sections from the block. This resulted in paired H&E and AE1/AE3 sections taken at two different levels.

The immunocytochemical staining was performed according to standard protocol. Briefly, histologic sections were deparaffinized and hydrated to distilled water. They were then steamed in a vegetable steamer for 20 minutes with Vector Kit antigen unmasking solution (Vector Labs, Burlingame, Calif.), cooled and rinsed with water and 3% hydrogen peroxide. They were then rinsed in PBS.times.3 for a total of 15 minutes and covered with 10% normal horse serum for 30 minutes. The excess PBS was drained and primary antibody (AE1/AE3) at a dilution of 1:50 was applied for 1 hour at room temperature. The sections were again rinsed in PBS.times.3 for a total of 15 minutes and then treated with 10% normal horse serum for 10 minutes. After draining the excess PBS, Vector stain biotinylated horse antimouse secondary antisera (Vector Labs, Burlingame, Calif.) was applied for 45 minutes. The sections were again rinsed in PBS.times.3 and then stained with Vector stain ABC solution for 3 minutes. After a further rinse in PBS.times.3, Vector diaminobenzedine solution was applied for 10 minutes. Sections were rinsed in distilled water for six rinses and the slides counterstained with Gill’s hematoxylin (Lerner Labs, Pittsburgh, Pa.) for 15 seconds. Sections were then dehydrated, cleared and mounted.

A single pathologist reviewed the original routine H&E slides, the recut H&E slides and the immunostained slides in a blinded fashion. Slides which were then positive for micrometastatic disease by either careful review of the original pathology, examination of the additional step section H&E pathology, or examination of the immunostained pathology were noted.

Validation of Multimarker RT-PCR Panel Primers

To establish the validity of a multimarker PCR panel for the detection of occult breast cancer micrometastases in axillary lymph nodes we 1) established the methodology for RT-PCR conditions, 2) demonstrated that the specific primer pairs are able to detect breast cancer cells, and 3) verified that the breast cancer gene specific primer pairs did not amplify genes from normal lymph node tissue. The breast cancer cell line MDA-231 exhibited bands that reflect the presence of .beta.-actin (a ubiquitous gene used as a positive control for the RT-PCR methodology), keratin-19, and c-myc; while the cell line MB-175 exhibited .beta.-actin, keratin-19, and PIP (FIG. 1). These findings demonstrated not only the ability of the RT-PCR panel to detect breast cancer cells, but also validated a multimarker approach as neither cell line expressed all of the screening markers. When RT-PCR was performed using the same methodology on nine control cervical lymph nodes from patients without cancer, each node exhibited the presence of the methodologic control .beta.-actin but no tumor markers, demonstrating the cancer specificity of the screen.

Southern Blot Analysis

Probes for the relevant primers are denatured by heating to 99.degree. C. and then end-labeled by incubation for 60 min. at 37.degree. C. with T45 polynucleotide kinase (promega) and .sup.32 P-ATP. The labeled probes are hybridized to the PCR products by adding 15 .mu.l of the PCR reaction mixtures to 10 .mu.l of a hybridization mixture containing 125 mM EDTA, 150 mM NaCl, a loading dye and one of the probes being utilized. The mixtures are denatured for 5 min. at 95.degree. C., and then annealed at 55.degree. C. The samples are loaded into 10% Tri-borate-EDTA gels (BioRad, Melville, N.Y.) and electrophoresed at 200 V for 45 minutes. The gels are removed from the glass sandwich, wrapped in plastic wrap, placed into a cassette and then autoradiographed on X-Omat AR film (Eastman Kodak Co., Rochester, N.Y.).

Comparison of Multimarker RT-PCR Screening of Breast Cancer Patients Axillary Lymph Nodes to Routine Histopathology

For 60 female and one male patient, average age was 55 years, an average of 4.4 (range 1-7) nodes per patient were obtained for RT-PCR analysis as described. The average number of nodes examined in the routine pathologic specimen was 19.6 (range 8-46). The histology for the 61 patients was as follows: 55 with invasive ductal carcinoma, 3 with invasive lobular carcinoma, 1 tubular carcinoma, 1 mucinous carcinoma, and 1 inflammatory carcinoma. Thirty-seven (60%) of these patients were found to have negative lymph nodes by pathologic evaluation. Using the presence of one or more tumor markers (c-myc, keratin-19 or PIP) as criteria for an RT-PCR positive specimen, 15 of the 37 pathologically negative patients exhibited evidence of micrometastases by RT-PCR analysis (40%). Two RT-PCR negatives were found among the 24 histologically positive specimens (8%) (table 1).

TABLE 1 ______________________________________ Comparison of Multimarker RT-PCR Screening of Breast Cancer Patients Axillary Lymph Nodes to Routine Histopathology Pathology Pathology RT-PCR positive negative Total ______________________________________ RT-PCR 22 (92%) 15 (40%) * 37 (61%) positive RT-PCR 2 (8%) 22 (60%) 24 (39%) negative Pathology 24 (39%) 37 (60%) 61 (100%) Total ______________________________________ *two of these pathology negative specimens were positive by step sectioning and immunohistochemical staining.

Comparison of Multimarker RT-PCR Screening to Step Sectioning and Immunohistochemical Staining

To be able to compare RT-PCR to the most sensitive methodology available by histopathology, axillary lymph node specimens identified as negative by routine H&E histologic evaluation were then re-evaluated with a blinded review of the original slides and further step sectioning with both H&E and immunohistochemical staining. Remarkably, none of the original slides were found to have missed disease on review. Of the 136 blocks re-cut, only 2 (1 from each of 2 patients) contained deposits of adenocarcinoma previously undiscovered at the time of initial diagnostic examination. These tumor deposits were microscopic and located in the peripheral sinus of the 2 lymph nodes. They were visualized on AE1/AE3 stain and could be located in the adjacent H&E stained sections. However, the deeper sections failed to show the deposits. One of the patients had been RT-PCR positive, and the other was RT-PCR negative. Interestingly, the histology on the latter was a mucinous carcinoma.

Staging of Disease by Routine Histopathology Versus Multimarker RT-PCR Screening

Using standard criteria and routine histopathology, the AJCC T.M. pathologic stage of this group of patients was: stage I-26, IIA-18, IIB-7, IIIA-7, IIIB-3, and IV-0. RT-PCR positivity in a screened lymph node was then used to define an N1 lymph node status for these patients to better define the potential impact the RT-PCR screen would have on pathologic staging. Using these criteria, RT-PCR identification of micrometastasis upstaged 15 of the 61 patients: stage I-18, IIA-19, IIB-14, III-7, IIIB-3, and IV-0. Eight of 26 pathologically stage I patients (30%) converted to stage IIA, while 7 of 18 stage I.A. patients (39%) were upstaged to IIB (FIG. 2).

Distribution of RT-PCR Markers According to Pathology Staging and Tumor Size

Specific marker frequency was then evaluated. In patients with pathologically positive lymph nodes c-myc was identified in 9 specimens, keratin-19 in 16 and PIP in 7. For pathologically negative patients c-myc was present in 14 specimens, keratin-19 in 2 and PIP in 3. Evaluating all of the RT-PCR panel positive patients, distribution of RT-PCR markers according to pathology staging and tumor size was noted. Interestingly, of the RT-PCR positive individuals who were pathologically stage I, 100% were found to be c-myc positive, 0% keratin and 0% PIP positive. By contrast for the stage IIIB patients only 50% were c-myc positive whereas 100% were positive for both keratin-19 and PIP (table 2). In a similar manner, 100% of the RT-PCR positive patients with T1 lesions were c-myc positive, with 50% keratin-19 and 25% PIP positive. These marker frequencies shifted to 55, 55 and 35% respectively in patients with T2 lesions. The term “T1″ is understood to mean tumors of less than of equal to 2 cm, and the term “T2″ is understood to mean tumors of less than or equal to 5 cm.

TABLE 2 ______________________________________ Distribution of RT-PCR markers according to routine pathology TNM staging and tumor size. RT-PCR Marker TNM Stage c-myc keratin-19 PIP ______________________________________ I 100% 0% 0% II.sub.A 90% 40% 20% II.sub.B 67% 67% 33% III.sub.A 14% 57% 28% III.sub.B 50% 100% 100% T.sub.1 100% 50% 25% T.sub.2 + * 55% 55% 35% ______________________________________ Percentages are derived from the number of individuals expressing a specific marker out of all RTPCR positive individuals for each particular stage. *This group includes T2-T4 tumors.

As can be seen, there is a differential distribution of positive RT-PCR markers according to pathology staging and tumor size (table 2). C-myc was present in 100% of stage 1 patients while keratin-19 and PIP were absent. C-myc is a proto-oncogene that plays a role in cell growth, differentiation, and apoptosis. It has been shown to be expressed in in situ cancer as well as invasive cancer, but not necessarily in axillary metastases [15]. It is expressed in 1-15% of all breast cancers and it is associated with high tumor grade and short relapse-free and overall survival [16]. This contrasts with the present data which suggests that c-myc was more commonly present within the earlier stages of breast cancer, and can be identified in axillary lymph nodes. Keratin-19 and PIP were both present with increasing frequency as clinical staging increased. The presence of keratin-19 has been shown to correlate with primary tumor size, lymphovascular invasion, and tumor grade, while PIP has been shown to be present in 61-98% of breast cancer primaries [13,20,23]. PIP was also found to positively correlate to estrogen receptor status, and is therefore thought to be a marker to identify patients with hormonally responsive disease [20]. One study has shown a significant improvement in relapse-free survival in patients who are PIP positive [22]. In contrast, our data would suggest that PIP is present in more advanced disease, and these patients should have a worse prognosis.

Analysis of the Relationship Between the Number of RT-PCR Markers Positive and Severity of Disease

Finally, further analysis was then performed to evaluate whether there was any correlation between the number of positive RT-PCR markers and routine pathologic staging or primary tumor size. Of the 38 specimens found to be positive by RT-PCR, 24 were c-myc positive, 19 keratin-19 positive, and 11 PIP positive. The presence of multiple tumor markers was more common in the histopathologically positive group: 2/24 had 3 markers, 10/24 had two markers, 10/24 had only one marker, and 2/24 only showed the positive control. For the pathologically negative specimens, 1/37 had 3 markers, 2/37 had two markers, 12/37 had one marker, and 22/37 had only the positive control. RT-PCR positivity in this group of patients correlated with primary tumor size with the mean number of RT-PCR markers positive for T1 lesions=0.53.+-.0.148, and for T2 or greater lesions=1.07.+-.0.15 (p<0.01). An analysis was then performed to compare the number of markers positive by RT-PCR to predicted survival to evaluate whether increasing number of RT-PCR markers bore any relationship to the severity of disease. The AJCC 5 year predicted survival per stage at presentation based on routine histopathologic evaluation [17] was used for this analysis as the impact of RT-PCR positivity on predicted survival has not currently been established. The mean number of RT-PCR markers positive per clinical stage upon presentation was calculated and a linear regression analysis was performed. A direct correlation appeared to exist between the number of positive markers by RT-PCR and predicted survival per stage (r=0.950, p<0.002) (FIG. 3).

Summary of Results

37 patients ALN were pathologically negative, of which 15 (40%) were positive by RT-PCR analysis. Two RT-PCR negatives among the 24 histologically positive specimens were detected (8%). The number of patients in each pathologic stage was: I-26, IIA-18, IB.-7, III-7, IIIB-3, and IV-0. By RT-PCR staging, 8 of 26 patients went from I to I.A. (30%), and 7 of 18 from IIA to IIB (39%). Of the RT-PCR positive individuals who were pathologically stage I, 100% were found to be c-myc positive, 0% keratin and 0% PIP positive, whereas for stage IIIB patients these markers were 50%, 100% and 100% respectively. Additionally, an increasing number of positive markers per specimen appeared to correlate with larger primary tumor size (p<0.01) and decreased predicted 5 year survival (r=0.950, p<0.002)).

Conclusions

The present multi-marker RT-PCR based methodology to identify axillary lymph node metastases in patients with breast cancer, appears to be a highly sensitive method for the detection of breast cancer micrometastases. This methodology could help identify patients at high risk for recurrence who may benefit from more aggressive adjuvant therapy, as well as give information about the aggressiveness of each tumor by showing a “footprint” of genetic markers. The sensitivity and low cost of the present RT-PCR staging method provides a powerful complement to routine histopathologic analysis of axillary lymph node biopsies.

EXAMPLE 2

Obtaining and Processing Sentinel Lymph Node and Other Non-Primary Tissue

Sentinel Lymph Node Biopsy

Patients undergo lymphoscintigraphy from 1 to 8 hours prior to the scheduled surgical procedure. Each patient receives approximately 10 mCi of non-filtered 99 technetium sulfur colloid in 4 cc sterile saline. Four 1 cc injections are given circumferentially around but not into either the tumor or biopsy cavity. This is guided either by palpation or ultrasound. Patients whose tumors were diagnosed by radiologic directed biopsy, undergo placement of a Kopans needle using the stereotactic coordinates. After injection of the isotope in the latter patients, the wire is placed, and confirmation of location performed with standard two view mammography. Gamma camera images are then obtained immediately in order to define the pathways of lymphatic drainage and to help identify the approximate location of the sentinel lymph node (SNL).

Patients with palpable tumors or prior open biopsy, undergo intraoperative injection of isosulfan blue dye around the tumor or into the walls of the biopsy cavity. A total of 3-5 cc will be used. Accurate placement of the injection can be facilitated by use of intraoperative ultrasound or by making a small incision down to the area of the lesion but remaining outside the lesion) as directed by the mammogram. Surgical dissection is performed in the usual fashion with tracing the blue lymphatics to the blue lymph node. An intraoperative hand held gamma counter (Neoprobe Corporation, Dublin, Ohio) is used for confirmation of the sentinel node based on 10 second counts. Sentinel node counts should be at least 10.times.background. The sentinel node is then surgically removed, with background gamma counts evaluated. If still elevated, the area is explored further for the presence of additional sentinel nodes until a negative background is achieved.

In patients undergoing mastectomy, a small axillary incision is made for sentinel node biopsy. The ellipse of skin for the mastectomy is fashioned to incorporate the axillary wound. Once the sentinel node is removed, mastectomy with standard incontinuity axillary dissection can then be performed.

The SLN specimens for standard RT-PCR processing are snap frozen in liquid nitrogen and stored at -70.degree. C. until further processing into RNA.

Bone Marrow Aspirate

The patients left and right anterior superior iliac crests are prepped and draped in the usual fashion. A 10 cc syringe with 18 ga needle is used to aspirate 10 to 12 milliliters of aspirate from two puncture sites on each anterior iliac crest (total of 40-50 ml) and placed in heparinized Falcon tubes with Dulbecco’s modified Eagle medium (DMEM, Gibco). The puncture sites are covered with sterile bandages. Bone marrow specimens then undergo isolation of cellular material with density gradient centrifugation, and the cellular component is snap frozen in liquid nitrogen and stored at -70.degree. C. until further processing into RNA.

Peripheral Blood

A total 30-40 cc of blood is drawn from a peripheral vein and stored in appropriate heparinized tubes. Peripheral blood specimens undergo isolation of cellular material with density gradient centrifugation, and the cellular component is snap frozen in liquid nitrogen and stored at -70.degree. C. until further processing into RNA.

Tissue Processing

For SNL testing, approximately 1 gram of snap frozen tissue is collected from portions of each patients harvested SLN and homogenized using a mechanical tissue homogenizer (Biospec Products, Bartlesville, Okla.). Single cell suspensions are washed, counted, and readied for RNA isolation as described in Example 1. The patient’s bone marrow aspirate and peripheral blood specimens (processed as described above) are thawed and used for RNA isolation directly as described in Example 1. Briefly, bone marrow aspirate and peripheral blood specimens will be counted using a hemocytometer with 5.times.10.sup.6 cells used for each RNA isolation. Total cellular RNA is isolated using the guanidium thiocynate-phenol-chloroform method.

Paraffin Embedded Tissues Processing

Five 4 .mu.m sections from each block of a patients paraffin-embedded blocks will be cut onto glass slides, dewaxed in xylene, and rehydrated. The RNA from these tissue sections will then be extracted by incubating in extraction buffer (100 mmol/1 NaCl, 10 mmol/1 Tris-HCl, 25 mmol/1 EDTA, and 0.5% wt/vol SDS) containing 2 mg/ml proteinase K, at 37.degree. C. for 3 days. RNA will then be extracted using 300 .mu.l of phenol (ph 4.5-5.5) and chloroform (1;1). The top RNA containing layer will be removed and used for subsequent RT-PCR analysis as previously described.

cDNA Processing an RT-PCR

This methodology is essentially the same as the axillary lymph node protocol described in Example 1 for all of the aforementioned specimens.

Although the present process has been described with reference to specific details of certain embodiments thereof, it is not intended that such details should be regarded as limitations upon the scope of the invention except as and to the extent that they are included in the accompanying claims.

Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.

REFERENCES

1. Henderson I, Harris J, Kinne D, Hellman S. Cancer of the Breast. In: Cancer, Principles and Practice of Oncology, ed. DeVita V, Hellman S, Rosenberg S, 3rd ed. Philadelphia: J B Lippincott; 1989: 1197-1268.

2. Valaguusa P, Bonadonna G, Veronesi U. Patterns of relapse and survival following radical mastectomy. Cancer 1978; 41: 1170-1178.

3. Gardner B, Feldman J. Are positive axillary nodes in breast cancer markers for incurable disease? Ann Surg 1993; 218: 270-277.

4. Bettelheim R, Price K, Goldhirsch A. Prognostic importance of occult axillary lymph node micrometastases from breast cancer. Lancet 1990; 335: 1565-1568.

5. McGurkin M, Cummings M, Walsh M, et al. Occult axillary node metastases in breast cancer: their detection and prognostic significance. Br J Cancer 1996; 73:88-95.

6. Mori M, Mimor K, Inove H, et al. Detection of cancer micrometastases in lymph nodes by reverse transcriptase polymerase chain reaction. Cancer Res 1995; 55:3417-3420.

7. Noguchi S, Aihara R, Nakamor S, et al. The detection of breast carcinoma micrometastases in axillary lymph nodes by means of reverse-transcriptase polymerase chain reaction. Cancer 1994; 74: 1595-1600.

8. Noguchi S, Aihara R, Nakamor S, et al. The detection of breast carcinoma micrometastases in axillary lymph nodes by means of reverse-transcriptase Polymerase chain reaction. Comparison between muc1 mRNA and keratin-19 mRNA amplification. Am J Path 1996; 148: 649-656.

9. Traweek S, Liu T, Battifora H. Keratin gene expression in non-epithelial tissues. Detection with polymerase chain reaction. Am J Path 1993; 142:1111-1117.

10. Wu S, Ben-Ezra J, Colombero A. Detection of micrometastases in breast cancer by the polymerase chain reaction: a feasibility study. Lab Invest 1990; 62: 109A.

11. Datta Y, Adams P, Drobyski W, et al. Sensitive detection of occult breast cancer by the reverse-transcriptase polymerase chain reaction. J Clin Immunol 1994;12: 475-482.

12. Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994; 54: 2986-2990.

13. Schoenfeld A, Luqmani Y, Sinnett H D, et al. Keratin 19 mRNA Measurement to detect micrometastases in lymph nodes in breast cancer patients. Br J Cancer 1996; 74: 1639-1642.

14. Noguchi S, Aihara R, Motamura K, et al. Histologic characteristics of breast cancers with occult lymph node metastases detected by keratin 19 mRNA reverse transcriptase-polymerase chain reaction. Cancer 1996; 78: 1235-1240.

15. Watson P, Safneck J, Le K, et al. Relationship of c-myc amplification to progression of breast cancer from in situ to invasive tumor and lymph node metastasis. JNCI 1993; 85: 902-907.

16. Watson P, Singh R, Hole A. Influence of c-myc on the progression of human breast cancer. Curr Topics Micro Immunol 1996; 213: 267-283.

17. Berns E, Foekens J, van Staveren I, et al. Oncogene amplification and prognosis in breast cancer: relationship with systemic treatment. Gene 1995; 159: 11-18.

18. Berns E, Klijn J, VanPutten W, et al. C-myc amplification is a better prognostic factor than her2/neu amplification in primary breast cancer. Cancer Res 1992; 52: 1107-1113.

19. Castro A, Buschbaum P, Nadji M, et al. Tissue immunoreactive prolactin hormone in breast cancer. Res Comm Chem Path Pharm; 1990, 29: 159-170.

20. Murphy L, Lee-Wing M, Goldenberg G, Shiu R. Expression of the gene encoding a prolactin-inducible protein by human breast cancers in vivo: correlation with steroid receptor status. Cancer Res 1987; 47: 4160-4164.

21. Shiu R, Iwasiow B. Prolactin-inducible proteins in human breast cancer cells. J Biol Chem 1985; 260: 11307-11313.

22. Pagani A, Sapino A, Eusebi V, et al. PIP/GCDFP-15 Gene expression and apocrine differentiation in carcinomas of the breast. Virchows Archive 1994; 425: 459-465.

23. Clark J, Shiu R, Orr F, Watson P. Reverse transcription polymerase chain reaction assay for prolactin-inducible protein gene expression to detect human breast cancer micrometastasis. PNAS, 1996; 37:86-87.

24. Hoon D, Wang Y, Dale P, et al. Detection of occult melanoma cells in blood with a multiple-marker polymerase chain reaction assay. J Clin Onc 1995; 13: 2109-2116.

25. Data on file with the National Cancer Data Base (Commission on Cancer of the American College of Surgeons and the American Cancer Society), 1989.

26. Myal Y, Robinson D, Iwasiow B, Tsuyuki D, Wong P, and Shiu R. The prolactin-inducible protein (PIP/GCDFP-15) gene: cloning, structure and regulation. Endocrinology 1991; 80:165-175.

27. Wreschener D, Hareuveni M, Tsarfaty I, Smorodinsky N, Horov J, Zaretsky J, Kotkes P, Weiss M, Lathe R, Dion A, and Keydar I. Human epithelial tumor antigen cDNA sequences. Differential splicing may generate multiple protein forms. Eur. J. Biochem. 1990; 189:463-473.

28. Hijya N, Setoguchi M, Matsuura K, Higuchi Y, Akizuki S, and Yamamato S. Cloning and characterization of the human osteopontin gene and its promoter. Biochem. J. 1994; 303:255-262.

29. Colby W, Chen E, Smith D, and Levinson D. Identification and nucleotide sequence of a human locus homologus to the v-myc oncogene of avian myelocytomatosis virus MC29. Nature 1983; 301:722-725.

30. Madden M, Morrow C, Nakagawa M, Goldsmith M, Fairchild C and Cowan K. Identification of 5′ and 3′ sequences involved in the regulation of tanscription of the human mdr 1 gene in vivo. The J. of Biol. Chem. 1993; 268:8290-8297.

31. Hedrick L, Kathleen R, Fearon E, Wu T, Kinzler K and Vogelstein B. The DCC gene product in cellular differentiation and colorectal tumorigenesis. Genes and Develop. 1994; 8:1174-1183.

32. Kim R, Shapiro H, Li J, Wrana J, and Sodek J. Characterization of the human bone sialo protein (BSP) gene and its promoter sequence. Matrix Biology 1994; 14:31-40.

33. Coussens L, Yang-Feng T, Liao Y, Chen E, Gray A, McGrath J, Seeburg P, Libermann T, Schlessinger J, Francke U, Levinson A and Ullrich A. Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science 1985;

Comments (0)

Enzyme screen for breast cancer

Filed under: Issued Patent — admin @ 3:26 am

Abstract
Methods and kits for diagnosing the presence of and prognosing the appearance of tissue remodelling-associated conditions, involving the presence of enzymes in a biological sample, are disclosed. In particular, the method pertains to diagnosing the presence of or prognosing appearance of cancer, metastatic cancer, and obstructive and degenerative conditions.

——————————————————————————–
Inventors: Moses; Marsha A. (Brookline, MA), Freeman; Michael R. (Boston, MA), Wiederschain; Dmitri (Brookline, MA)
Assignee: The Children’s Medical Center Corp. (Boston, MA)

Appl. No.: 08/843,095
Filed: April 25, 1997
Parent Case Text

——————————————————————————–

RELATED APPLICATIONS

This application is a continuation-in-part application of Ser. No. 08/639,373 filed on Apr. 26, 1996, now pending.
——————————————————————————–

Claims

——————————————————————————–

We claim:

1. A method for facilitating the diagnosis of a subject for a breast cancer, comprising:

obtaining a urine sample from a subject;

detecting the presence or absence of the activity of a gelatinase having a molecular weight of 125 kDa in the biological sample; and

correlating the presence or absence of the activity of the gelatinase with the presence or absence of breast cancer, thereby facilitating the diagnosis of the subject for breast cancer.

2. The method of claim 1, wherein the gelatinase is in its proenzyme form.

3. The method of claim 1, wherein the subject has previously been treated surgically.

4. The method of claim 1, wherein the gelatinase is detected by an electrophoretic pattern.

5. The method of claim 4, wherein the electrophoretic pattern is a zymogram.

6. The method of claim 5, wherein the zymogram substrate is selected from the group consisting of gelatin, casein, fibronectin, vitronectin, plasmin, plasminogen, type IV collagen, and a derivative of type IV collagen.

7. The method of claim 1, wherein the gelatinase is detected immunochemically.

8. The method of claim 7, wherein the gelatinase is detected by a radio-immune assay.

9. The method of claim 7, wherein the gelatinase is detected by an enzyme-linked immunosorbant assay.
——————————————————————————–

Description

——————————————————————————–

BACKGROUND OF THE INVENTION

A class of disorders may be characterized as tissue remodelling-associated conditions, and includes cancers, arthritic conditions, obstructive disorders, degenerative disorders, and problematic wound-healing and ulcerative disorders. Paradigmatic among these is prostate cancer (CaP), the leading source of new cases of cancer in men in this country, and the second leading cancer cause of cancer death after lung cancer. Over 40,000 Americans are estimated to have died of CaP in 1995, and about 244,000 new cases of prostate cancer were detected (Cancer Facts and Figures–1995, American Cancer Society, Inc., 1995) and these numbers have increased annually at an alarming rate. Further, the rate of appearance of prostate cancer in African-American men is 37% higher than for their white counterparts (Jaroff, L. (Apr. 1, 1996), Time).

The current primary diagnostic tool for disorders of the prostate is measurement of the level of prostate-specific antigen (PSA) in blood, which in normal men ranges from 0 to 4 nanograms/milliliters. Prostate enlargement, a condition known as benign prostatic hyperplasia (BPH), is found in about half of men over age 45. With BPH, PSA levels rise in proportion to prostate size, possibly obscuring diagnosis of CaP. In addition, a significant proportion of men with CaP have normal PSA levels. The PSA test is somewhat non-specific for distinguishing CaP and BPH, and produces a degree of false negative results (Garnick, M., (1993), Am. Inst. Med, 118:804-818). Further, the PSA test is somewhat invasive, requiring the subject to give a blood sample, a procedure that requires trained personnel, in the setting of a doctor’s office or clinic. The PSA test, a major advance over previous procedures, thus leaves much to be desired.

CaP is treated by surgery, radiation therapy, cryotherapy or implantation of radioactive seeds, or a combination of these procedures. In choosing one of these treatments, consideration is also taken of possible sequelae that impact negatively on quality of life, such as temporary or long-term incontinence and impotence. Further, following surgical or chemotherapeutic treatment, production of testosterone is suppressed hormonally, to discourage metastases in the CaP patient. Hormonal suppression is found to be effective for several years duration, however cancer cells that have metastasized eventually become resistant to the drugs of hormonal suppression. CaP metastasis to other sites is inevitably fatal. Only a small percent of men with microscopically-detectable CaP progress to metastatic cancer and actually die of this disease. A current medical approach, particularly for the elderly, is “watchful waiting”, wherein tumors are not treated but rather monitored for progression.

SUMMARY OF THE INVENTION

The present invention provides biological markers to non-invasively monitor the diagnosis and prognosis of prostate disorders and other tissue remodelling-associated conditions. This invention provides methods and kits using non-invasive procedures for detection of tissue remodelling-associated conditions in subjects and patients, for diagnosis of diseases such as prostate cancer, breast cancer, ovarian cancer, brain tumors, arthritic conditions, obstructive conditions, and ulcerative conditions. The primary screens use biological fluid samples that may be obtained by personnel without medical training, and do not require visiting a clinic or hospital. The statistical association between positive results and occurrence of tissue remodelling-associated conditions are applied to early diagnoses of the appearance of these conditions, and to prognoses of changes in these conditions.

The present invention features non-invasive methods for facilitating diagnosis of a subject for a tissue remodelling-associated condition. The method involves obtaining a biological sample from that subject and detecting an enzyme in that sample, facilitating the diagnosis. The non-invasive method was based at least in part, on the observation of full length, active intact enzymes that are normally associated with the process of tissue remodelling, in urine samples from patients with certain conditions. For example, gelatin-degrading matrix metalloproteinases and other proteases have been found in the urine of cancer patients. Further, high statistical associations between presence of prostate cancer and appearance of certain enzymes in urine, and between metastatic cancer and certain enzymes in urine, have been found.

The tissue remodelling conditions that can be monitored by the methods of this invention include a variety of types of cancer; moreover, the enzymes are suitable for diagnosis of other tissue remodelling conditions, such as arthritis, degenerative conditions, and obstructive conditions. The invention provides non-invasive methods for diagnosing these conditions by assay for enzymes in biological fluids.

More preferably, the methods of this invention embody detection of enzymes in urine, for diagnosis and prognosis of cancer, and most preferably, prostate cancer. The invention also relates to diagnosis and prognosis of metastatic prostate cancer. The varieties of cancer suitable for diagnosis by the methods of this invention include, among others, cancers of epithelial origin, for example, cancers of the nervous system, breast, retina, lung, skin, kidney, liver, pancreas, genito-urinary tract, ovarian, uterine and vaginal cancers, and gastrointestinal tract cancers, which form in cells of epithelial origin. Using the methods described here, cancers of mesodermal and endodermal origin, for example, cancers arising in bone or in hematopoietic cells, are also diagnosed.

In a preferred embodiment, the enzymes that are detected are matrix-digesting enzymes, more preferably, enzymes that are proteinases, and most preferably, enzymes that are metalloproteinases. In a different aspect, the methods of this invention involve enzymes that are full-length active enzymes, and they are matrix metalloproteinases. In another aspect, the method involves removal of low molecular weight contaminants from urine prior to the detection step; preferably, the urine is dialyzed to remove low molecular contaminants prior to the detection step.

Another aspect of the methods features a fully non-invasive means for facilitating the diagnosis of a subject for a disorder of the prostate. A urine sample is obtained from the subject, and a prostate disorder-associated enzyme is detected in the urine sample, facilitating the diagnosis of that subject for the prostate disorder. More preferably, the prostate disorder-associated enzyme is a matrix-digesting enzyme, most preferably, a proteinase which is a metalloproteinase. The disorders of the prostate include benign prostatic hyperplasia, “problematic” prostatic hyperplasia, organ-defined prostate cancer, this cancer which may previously have been treated surgically or chemically, and particularly, situations in which metastatic cancer is suspected. The method encompasses diagnosis of subjects who are being treated hormonally with agents that block testosterone.

The invention facilitates diagnosis of subjects for prostate cancer, using a urine sample from such subjects, and detecting one or more prostate cancer-associated enzymes. Enzymes of the matrix metalloproteinase class are among those that are diagnostic, and in the case of prostate cancer, the method involves detection of gelatinase A, gelatinase B, and related activities. More preferably, the detected metalloproteinase enzyme has a molecular weight approximately equal to 72 kDa, 92 kDa, or equal to or greater than approximately 150 kDa. Yet another feature of the invention is a method for prognosis of metastatic prostate cancer, by obtaining a biological sample from a subject and detecting a metastatic prostate cancer-associated enzyme in that biological sample facilitating the prognosis of metastatic prostate cancer. In the preferred embodiment for detecting these enzymes, low molecular weight contaminants are removed from the urine prior to the detection step.

Detection of enzymes in biological fluids may be by electrophoresis, and a preferred method of analysis of the electrophoretogram is to develop a pattern of enzyme migration mobilities as a zymogram. The zymogram involves incorporating an enzymatic substrate into the inert matrix in which the enzyme species migrate. Examples of suitable substrates are type IV collagen or a derivative of a type IV collagen, and in the Examples used here, the substrate is the collagen derivative gelatin. Other convenient protein substrates, e.g., casein, are also encompassed by the methods of the invention. Other methods of enzyme detection may be immunochemical, for example, the enzymes may be detected by radio-immune assay or by enzyme-linked immunosorbant assay.

The invention features kits for facilitating diagnosis and prognosis of tissue remodelling-associated conditions, which have a container with a reagent for detecting an enzyme in a urine sample, and instructions. In a preferred embodiment of the kit, the tissue remodelling-associated conditions being detected are one or more types of cancer, for example, organ-confined prostatic cancer, metastatic cancer, and prognosis of metastasis in a prostate cancer patient. In a different embodiment, the tissue remodelling-associated condition is an arthritic, obstructive, or degenerative condition.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides non-invasive methods, between presence of enzymes in biological fluids, and diagnosis and prognosis of tissue remodelling-associated conditions (TRACs), especially cancers, obstructive and degenerative conditions, and arthritic conditions, and kits for use for such diagnosis and prognosis. Diagnoses and prognoses for TRACs have been developed based on observed statistical associations between these conditions and the presence of a pattern of enzymes in biological fluids. For convenience, certain terms employed in the specification, examples and appended claims are collected here.

The term “subject,” as used herein, refers to a living animal or human in need of diagnosis or prognosis for, or susceptible to, a condition, in particular an “tissue remodelling-associated condition” as defined below. The subject is an organism capable of responding to tissue remodelling signals such as growth factors, under some circumstances, the subject is susceptible to cancer and to arthritis. In preferred embodiments, the subject is a mammal, including humans and non-human mammals such as dogs, cats, pigs, cows, sheep, goats, horses, rats, and mice. In the most preferred embodiment, the subject is a human. The term “subject” does not preclude individuals that are entirely normal with respect to tissue remodelling-associated conditions or normal in all respects. The subject may formerly have been treated surgically or by chemotherapy, and may be under treatment by hormone therapy or have been treated by hormone therapy in the past.

The term “patient,” as used herein, refers to a human subject who has presented at a clinical setting with a particular symptom or symptoms suggesting one or more diagnoses. A patient may be in need of further categorization by clinical procedures well-known to medical practitioners of the art (or may have no further disease indications and appear to be in any or all respects normal). A patient’s diagnosis may alter during the course of disease progression, such as development of further disease symptoms, or remission of the disease, either spontaneously or during the course of a therapeutic regimen or treatment. In the invention here, a patient described in the Examples is listed with other patients according to the most recent diagnosis of the medical condition, and any previous diagnoses, if different, are described in the text. Thus, the term “diagnosis” does not preclude different earlier or later diagnoses for any particular patient or subject. The term “prognosis” refers to assessment for a subject or patient of a probability of developing a condition associated with or otherwise indicated by presence of one or more enzymes in a biological sample, preferably in urine.

The term “biological sample” includes biological samples obtained from a subject. Examples of such samples include urine, blood taken from a prick of the finger or other source such as intravenous, blood fractions such as serum and plasma, feces and fecal material and extracts, saliva, cerebrospinal fluid, amniotic fluid, mucus, and cell and tissue material such as cheek smear, Pap smear, fine needle aspiration, sternum puncture, and any other biopsied material taken during standard medical and open surgical procedures.

The term “invasiveness” as used here with respect to metastatic cancer (Darnell, J. (1990), Molecular Cell Biology, Third Ed, W. H. Freeman, NY) is distinct from the use of the term “invasive” to describe a medical procedure, and the distinction is made in context. “Invasive” for a medical procedure pertains to the extent to which a particular procedure interrupts the integrity of the body. “Invasiveness” ranges from fully non-invasive, such as collection of urine or saliva; to mildly invasive, for example a Pap smear, a cheek scrape or blood test, which requires trained personnel in a clinical setting; to more invasive, such as a sternum marrow collection or spinal tap; to extensively invasive, such as open surgery to detect the size and nature of tumors by biopsy of material, taken for example during brain surgery, lung surgery, or transurethral resection in the case of prostate cancer.

The term “invasive” is also used with respect to proclivity of a tumor for expanding beyond its boundaries into adjacent tissue, or to the characteristic of the tumor with respect to metastasis (Darnell, J. (1990), Molecular Cell Biology, Third Ed., W. H. Freeman, NY). For example, a basal cell carcinoma of the skin is a non-invasive or minimally invasive tumor, confined to the site of the primary tumor and expanding in size, but not metastasizing. In contrast, the cancer melanoma is highly invasive of adjacent and distal tissues. The invasive property of a tumor is often accompanied by the elaboration of proteolytic enzymes, such as collagenases, that degrade matrix material and basement membrane material to enable the tumor to expand beyond the confines of the capsule, and beyond confines of the particular tissue in which that tumor is located. Elaboration of such enzymes may be by endogenous synthesis within the tumor cells, or may be elicited from adjacent cells or by circulating neutrophils, in which cases the elicitation by the tumor results from chemical messengers elaborated by the tumor and expression of the enzymes occurs at the tumor site or proximal to the tumor. The enzymes of the present invention are not intended to be limited to those produced exclusively as endogenous tumor products, but are found in biological samples in patients in need of or subjects in need of prognosis or diagnosis of TRACs.

Cancer or neoplasia is characterized by deregulated cell growth and division. A tumor arising in a tissue originating from endoderm or exoderm is called a carcinoma, and one arising in tissue originating from mesoderm is known as a sarcoma (Darnell, J. (1990), Molecular Cell Biology, Third Ed., W. H. Freeman, NY). A current model of the mechanism for the origin of a tumor is by mutation in a gene known as an oncogene, or by inactivation of a second tumor-suppressing genes (Weinberg, R. A., (September 1988), Scientific Amer., 44-51). The oncogenes identified thus far have arisen only in somatic cells, and thus have been incapable of transmitting their effects to the germ line of the host animal. In contrast, mutations in tumor-suppressing genes can be identified in germ line cells, and are thus transmissible to an animal’s progeny. Examples of cancers include cancers of the nervous system, breast, retina, lung, skin, kidney, liver, pancreas, genito-urinary tract, gastrointestinal tract, cancers of bone, and cancers of hematopoietic origin such as leukemias and lymphomas. In one embodiment of the present invention, the cancer is not a cancer of the bladder.

An arthritic condition such as rheumatoid arthritis is an example of a TRAC since the disease when chronic is characterized by disruption of collagenous structures (J. Orten et al., (1982), Human Biochemistry, Tenth Ed., C. V. Mosby, St. Louis, Mo.). Excess collagenase is produced by cells of the proliferating synovium. Other TRAC conditions such as ulcerative, obstructive and degenerative diseases are similarly characterized by alterations in the enzymes of metabolism of structural proteins.

The term “prostate cancer” (CaP) as used herein refers to both the appearance of a palpable tumor of the prostate, and also to microscopically detectable neoplastic or transformed cells in the prostate gland. In the latter case, the said cytologically-detectable prostate cancer may be asymptomatic, in that neither the patient nor the medical practitioner detects the presence of the cancer cells. It is estimated that 10 million American men carry microscopic CaP (M. Garnick, (April 1994), Sci. Am., 78). Cancer cells are generally found in the prostates of men who live into their seventies or eighties, however not all of these men develop prostate cancer (CaP). Autopsies show microscopic clusters of prostate cancer cells in one-third of men who die of other causes (Thayer, W., (Mar. 19, 1996), quoted in Nutr. Act. Newsletter, 23(2):12). Death rates from prostate cancer rise after age 55, and new cases of prostate cancer, are increasing even faster than the death rate. CaP is the second leading cause of cancer death in men, causing over 40,000 deaths in 1995. In the event that prostate cancer metastasizes to additional sites distal to the prostate, the condition is described as metastatic cancer (MC), or prostate cancer, metastasized, to distinguish this condition from organ-confined prostate cancer. CaP fatality results from metastatic dissemination of prostatic adenocarcinoma cells to distant sites, usually in the axial skeleton.

The term “organ-confined”, as used herein, refers to prostate cancer that has not metastasized beyond the boundaries of the prostate gland, i.e., has not been found by techniques familiar to those skilled in the art to occur in any organs or tissues beyond the prostate gland. It can not be ruled out, however, that some number of cells have metastasized, however they are not detected by ordinary techniques used by those with skill in the art.

The term “metastasis” as used herein refers to the condition of spread of cancer from the organ of origin to additional distal sites in the patient. Preferential target organs are common to cancer types, e.g., CaP frequently metastasizes to bone, with concomitant symptoms such as back pain and acute urinary retention, and high levels of mortality. Metastatic cancer (MC) as exemplified for the purposes of this invention, is not limited to spread of CaP to bone or any particular organ, and includes also spread of other cancers such as kidneys (renal), breast, and gastrointestinal tract to organs beyond these primary sites.

The phrase “benign prostatic hypertrophy,” as used herein, comprises an age-related non-cancerous enlargement of the prostate, and affects more than 50% of men over age 45 (Garnick, supra). Benign prostatic hypertrophy (BPH) may be asymptomatic, that is, have no negative consequences for the individual, and is not intended here to imply the necessary development of prostate cancer. BPH is accompanied by an increase in production of the protein prostate specific antigen (PSA discussed infra), proportional to the extent of growth of the prostate gland. For this reason, the diagnosis of CaP in a BPH patient may be difficult to distinguish from further asymptomatic growth by sole use of the PSA test (vide infra).

BPH may appear as or may progress to “problematic” prostatic hyperplasia, with symptoms that include urinary urgency, frequency, and hesitancy, and penile erectile difficulties. Since these same symptoms are associated with CaP (M. Garnick, (1993), Annals Int. Med., 118(10):804-818), the clinician distinguishes CaP and problematic prostatic hyperplasia by the suddenness in onset of symptoms, and by additional diagnostic tests (described below). BPH and problematic prostatic hypertrophy may also progress to CaP, however these terms are meant neither to exclude nor to imply disease progression, as the full range of diagnostic possibilities is found for the BPH patient population as for the normal subject.

At present, the primary diagnostic tool for prostate disorders is a blood test that measures prostate specific antigen (PSA) levels. Elevated PSA is associated both with CaP and with BPH, and PSA levels also increase with age. In cases of CaP, removal of the prostate should produce a PSA reading of zero, and a subsequent positive PSA reading in the blood indicates that the cancer has metastasized, a condition that is incurable and fatal. CaP that remains organ-confined is treated primarily by surgery and hormone therapy to block testosterone, treatments that frequently cause a variable period of incontinence and loss of libido, and may only temporarily block tumor growth or metastasis.

Hormone suppression of recurrence and metastasis of prostate cancer is possible because CaP is a sex hormone dependent cancer (Smith, P. (1995), Cancer Surveys Vol. 23: Preventing Prostate Cancer, Imper. Cancer Research Fund); that is, the growth of the cancer is promoted by male hormones (e.g., androgens such as testosterone and dihydrotestosterone). Removal of the testes (castration) was for many years the standard method of preventing secretion of male hormones by the gonads, to reduce growth of the cancer. Currently, secretion of male hormones is suppressed by chemical means by interfering with production of luteinizing hormone (LH), which regulates synthesis of male hormones. Similar considerations are applicable to other sex hormone-dependent cancers, such as breast or ovarian cancer.

Beyond detection of elevated PSA level, other current diagnostic methods for CaP are known to medical practitioners skilled in the art and include rectal examination, transrectal ultrasonography or magnetic resonance imaging (MRI), bone scanning, X-rays, skeletal survey, intravenous pyelography, CAT-scan, and biopsy (reviewed in Garnick, M. (1993), Annals of Internal Medicine, 118:803-818; and Garnick, M. (1994), Scientific American, 270:72-81). These procedures are invasive, complex, costly, and require highly trained personnel.

CaP stages are commonly evaluated according to a scale divided as A, B, C and D. Tumors in stage A are microscopic; stage A.sub.1 designates tumors confined to a relatively small area and composed of well-differentiated tissue; stage A.sub.2 tumors are more diffuse and less well differentiated; stage B tumors are large enough to be felt during a rectal examination; and stage C prostate cancers have spread throughout the gland and typically have pushed past the borders of the prostate into surrounding structures. Stage D tumors have metastasized, e.g., to lymph nodes, bone, or other organs. Alternatively, tumors are also staged by the TNM staging system, in which tumors are ranked on a scale of progressively worsening disease from T1a to T1b (e.g., T1c tumors are non-palpable and non-visible that were detected by elevated blood levels of prostate specific antigen). Of tumors characterized as being is stages A2, B, or C, 25% to 50% turn out, on further testing, to be metastatic (Garnick, supra). Methods involving procedures for removal or destruction of prostatic tumor tissue usually are employed with non-metastasized cancers. For example, radical prostatectomy preferably is used with stage A, B and some stage C tumors (i.e., where the tumor growth has not extended considerably beyond the borders of the prostate gland) as well as stage T1c tumors. X-ray therapy (e.g., external or interstitial) preferably is used with stage A, B or C tumors as well as T1c tumors. Additional diagnostic tools might aid in distinguishing cases suitable for various treatments.

In the present invention, detection of a pattern of enzymes in a biological sample from a subject is used to facilitate diagnosis and prognosis of TRAC by offering statistical associations with particular conditions. The term “enzymes” is art recognized and includes protein catalysts of chemical reactions. The enzyme for purposes of this invention can be a whole intact enzyme or portions or fragments thereof. The preferred embodiment of the term enzymes as used herein, are naturally occurring enzymes that catalytically degrade proteins, i.e. the enzymes known as proteases or proteinases. By proteinase is meant a progressive exopeptidase that digest proteins by removing amino acid residues from either the N terminal or C terminal which reaction proceeds to achieve significant degradation, or an endopeptidase which destroys the amide bond between amino acid residues with varying degrees of residue specificity. The term “protease” may also include the highly specific amino acid peptidases that remove a single amino acid from an N terminus or C terminus of a protein. Examples are alanine aminopeptidase (EC 3.4.11.2) and leucine aminopeptidase (EC 3.4.11.1), which remove alanine or leucine, respectively, from the amino terminus of a protein that may have alanine and leucine, respectfully, at the amino terminus. Molecular weights of enzymes of the invention are included in, but not limited to, molecular weights in the range of approximately 20 kDa to approximately 200 kDa, more preferably 50 kDa to approximately 150 kDa.

The more preferred embodiment of the term protease designates an enzyme which can actually cause digestion of a protein yielding a product with a significantly lower molecular weight than the substrate material. The term “enzyme” includes polymorphic variants that are silent mutations naturally found within the human population. The enzymes in the best embodiment of the invention are proteases or proteinases, however there is no intent to limit the invention to these enzymes. The term proteases (and its equivalent term proteinases) is intended to include those endopeptidases and progressive exopeptidases that are capable of substantially reducing the molecular weight of the substrate and destroying its biological function, especially if that biological function of the substrate is to be a structural component of a matrix barrier. Amino acid peptidases such as alanine aminopeptidase and leucine aminopeptidase are also broadly included among proteases, however do not share the property of significantly reducing the molecular weight of the substrate protein.

Many thousands of proteases occur naturally, and each may appear at different times of development and in different locations in an organism. The invention herein features enzymes of the class of the matrix metalloproteinases (MMPs, class EC 3.4.24). These enzymes, which require a divalent cation for activity, are normally expressed early in the development of the embryo, for example, during hatching of an zygote from the zona pellucida, and again during the process of attachment of the developing embryo to the inside of the uterine wall. Enzyme activities such as N-acetylglucosaminidase (EC 3.2.1.50) appear in urine in the case of renal tubular damage, for example, due to diabetes (Carr, M., (1994), J. Urol. 151(2):442-445; Jones, A., et. al., (1995), Annals. Clin. Biochem., 32:68-62). That these activities appear in urine as a result of renal tubular damage is irrelevant to the present invention as described herein.

The language “matrix-digesting enzyme” refers to an enzyme capable of digesting or degrading a matrix, e.g., a mixture of proteins and proteoglycans that comprise a layer in a tissue on which certain types of cells are found. Matrix-digesting enzymes are expressed during stages of normal embryogenesis, pregnancy and other processes involving tissue remodelling. In addition, some of these enzymes, for example some matrix metalloproteinases (MMPs), degrade the large extracellular matrix proteins of the parenchymal and vascular basement membranes that serve as mechanical barriers to tumor cell migration. These MMPs are produced in certain cancers and are associated with metastasis (Liotta, L. A., et al., (1991), Cell, 64:327-336). Examples of MMPs are the type IV collagenases, e.g., mmp-2 (gelatinase A. EC 3.4.24.24) and mmp-9 (gelatinase B, 3.4.24.35), and stromelysins (EC 3.4.24.17 and 3.4.24.22). Some MMPs are specifically inhibited by molecules called tissue inhibitors of metalloproteinases (TIMPs, Woessner, J. F., Jr., (1995), Ann. New York Acad. Sci., 732:11-21), which also may be overproduced by tumor cells, however under certain conditions enzyme activity is in molar excess over the TIMPs (Freeman, M. R. et al., (1993), J. Urol., 149:659; Lu, X. et al. (1991), Cancer Res., 51:6231-6235,; Kossakowska, A. E. et al., (1991), Blood, 77:2475-2481). In one embodiment of this invention, the inhibitors of the enzyme (TIMPS, e.g., TIMP-1 or TIMP-2) may be the biological markets detected in the biological sample (e.g., complexed or free form) rather than the enzyme per se. The detection of the inhibitors can be accomplished using art-recognized techniques. Many of MMPs are translated as pro-enzymes, and may be found in a variety of structures, with ranges of molecular weights including smaller forms (45 kDa, 55 kDa, 62 kDa), and larger forms (72 kDa, 82 kDa, 92 kDa, and higher polymers such as 150 kDa and greater).

The language “prostate cancer-associated enzyme” or “prostate disorder-associated enzyme” is intended to include enzymes whose detection in a biological sample of a subject would facilitate diagnosis of prostate cancer or a prostate disorder. Examples include MMPs in a range of approximately 20 kDa to 200 kDa, more preferably approximately 50 kDa to approximately 150 kDa, e.g., more particularly approximately 72 kDa, 92 kDa, or 150 kDa. Presentation of these sizes do not preclude additional enzymes of larger or smaller sizes. In one embodiment of the invention, the enzyme is not an enzyme of a size of approximately 72 kDa or approximately 44 kDa. In addition to the MMPs, other types of proteases may be produced and activated in some types of cancer, for example, plasminogen may be expressed and activated by proteolytic cleavage to the protease plasmin (EC 3.4.21.7).

The term “electrophoresis” is used to indicate any separation system of molecules in an electric field, generally using an inert support system such as paper, starch gel, or preferably, polyacrylamide. The electrophoresis methods with polyacrylamide gels and the sodium dodecyl sulfate denaturing detergent are described in the Examples below. The protocols are not intended to exclude equivalent procedures known to the skilled artisan. Other SDS polyacrylamide procedures, known to the skilled artisan, may be used, e.g., a single polyacrylamide concentration such as 10%, may be substituted for the gradient in the separation gel. The physical support for the electrophoretic matrix may be capillary tubes rather than glass plates. Details of several SDS-polyacrylamide gel electrophoresis systems are described in many review articles and biotechnology manuals (e.g., Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). The method is not limited to use of SDS and other detergents. Further, electrophoresis in the absence of detergents may be employed. Proteins may be separated under non-denaturing conditions, for example in the presence of urea on a polyacrylamide matrix (Maniatis, supra), or by charge, for example by the procedure of iso-electric focussing.

In using an electrophoretic technique for separation of enzymes, the electrophoretogram may be developed as a zymogram. The term “zymography” is meant here to include any separations system utilizing a chemically inert separating or support matrix, that allows detection of an enzyme following electrophoresis, by exposing the matrix of the separations system to conditions that allow enzyme activity and subsequent detection. More narrowly, the term zymography designates incorporation of an appropriate substrate for the enzyme of interest into the inert matrix, such that exposing the matrix to the conditions of activity after the electrophoresis stop yields a system to visualize the precise location, and hence the mobility, of the active enzyme. By techniques well-known to the skilled artisan, the molecular weights of proteins are calculated based on mobilities derived from positions on a zymogram. Such techniques include comparison with molecular weight standards, the mobilities of which are determined from general protein stains or from pre-stains specific to those standards, and comparison with positive controls of purified isolated enzymes of interest, which are visualized by the technique of the zymogram, i.e., enzyme activity.

In particular, substrates for detection of proteases by zymography are included in the electrophoresis matrix. For type IV collagenases, the natural substrate is a type IV collagen and gelatin, a type I collagen derivative, is used for the zymography substrate in the Examples presented herein. However other proteins that are suitable for detection of further proteases of interest in TRAC diagnosis, for example, include fibronectin; vitronectin; collagens of types I through III and V through XII; procollagens; elastin; laminin; plasmin; plasminogen; entactin; nidogen; syndecan; tenascin; and sulfated proteoglycans substituted with such saccharides as hyaluronic acid, chondroitin-6-sulfate, condroitin-4-sulfate, heparan sulfate, keratan sulfate, and dermatan sulfate and heparin. Further, convenient inexpensive substrate proteins such as casein, which may not be the natural target of a protease of interest, but are technically appropriate, are included as suitable substrate components of the zymography techniques of the present invention. Chemically synthesized mimetics of naturally occurring protein substrates are also potential zymography substrates, and may even be designed to have favorable properties, such chromogenic or fluorogenic ability to produce a color or fluorescent change upon enzymatic cleavage.

Zymography may be adapted to detection of a protease inhibitor in the biological sample. Since a variety of natural MMP inhibitors are elaborated, such as TIMP-1 and TIMP-2, and are found to be deregulated during TRAC situations, the present invention includes detection of enzyme inhibitors as well as the enzymes of tissue remodelling. Thus for example, a “reporter enzyme” for which enzyme an inhibitory activity is being measured, may be incubated with each biological sample obtained by subjects and patients, in one or more quantities corresponding to one or more aliquots of sample, prior to electrophoresis. This enzyme is omitted from one aliquot of the biological sample. The inhibitory presence in the sample is detected as disappearance or decrease of the reporter enzyme band from the developed zymogram. Alternatively, functional enzyme activity assays which include in the reaction mix a known level of active enzyme, to which is added aliquots of experimental samples with putative inhibitory activity, can detect the presence of inhibitors.

Further, the enzymes of tissue remodelling extend to enzyme activities beyond those of proteolytic activity. For example, enzymes that are substituted with residues such as glycosyl, phosphate, sulfate, lipids and nucleotide residues (e.g. adenyl) are well-known to those skilled in the art. These residues are in turn added or removed by other enzymes, e.g., glycosidases, kinases, phosphatases, adenyl transferases, etc. Convenient detection methods for the presence of such activities for TRAC diagnosis and prognosis are readily developed by those with skill in the art, and are intended to comprise part of the invention here.

If activities are found in urine associated with renal damage, these may be detected by the methods described here, in which case positive data obtained with the methods of the present invention must be evaluated by including renal damage as a causative condition. Overlap between renal damage and TRAC diagnoses of course exist, e.g., renal cancer, renal tubule obstruction, renal ulcers, etc. The utility of the present invention is not construed as limited by the possibilities of an overlap, nor limited by knowledge of such conditions.

The zymogram as described in the Examples herein is developed by use of a general stain for protein, in this case, Coomassie Blue dye. The development is possible with general protein stains, e.g., Amido Black dye, and SYPRO Orange stain (Biorad Laboratories, Hercules, Calif. 94537). Further, enzyme activity may be detected by additional techniques beyond that of a clear zone of digestion in a stained matrix, for example, by absence of areas of radioactivity with a radio-labelled substrate, by change in mobility of a radio-labelled substrate, or by absence of or change in mobility of bands of fluorescence or color development with use of fluorogenic or chromogenic substrates, respectfully.

Quantitative densitometry can be performed with zymograms by placing the gel directly on an activated plate of a Molecular Dynamics phosphorimager (Molecular Dynamics, 928 East Arques Ave., Sunnyvale, Calif. 94086), or with a Datacopy G8 plate scanner attached to a MacIntosh computer equipped with an 8-bit videocard and McImage (Xerox Imaging Systems). Background measurements, areas of the gel separate from sample lanes, can similarly be scanned, and values subtracted from the readings for enzyme activities.

Another electrophoretically-based technique for analysis of a biological sample for presence of specific proteins is an affinity-based mobility alteration system (Lander, A., (1991), Proc. Natl. Acad. Sci. U.S., 88(7):2768-2772). An MMP or other type of enzyme of interest might be detected, for example, by inclusion of a substrate analog that binds essentially irreversibly to the enzyme, hence decreasing the mobility. The affinity material is present during electrophoresis, and is incorporated into the matrix, so that detection of the enzyme of interest occurs as a result of alteration of mobility in contrast to mobility in the absence of the material. Yet another technique of electrophoretic protein separation is based on the innate charge of a protein as a function of the pH of the buffer, so that for any protein species, there exists a pH at which that protein will not migrate in an electric field, or the isoelectric point, designated pI. Proteins of a biological sample, such as a urine sample, may be separated by isoelectric focussing, then developed by assaying for enzymatic activity for example by transfer to material with substrate, i.e., zymography. Electrophoresis is often used as the basis of immunological detections, in which the separation step is followed by physical or electrophoretic transfer of proteins to an inert support such as paper or nylon (known as a “blot”), and the blotted pattern of proteins may be detected by use of a specific primary binding (Western blot) by an antibody followed by development of bound antibodies by secondary antibodies bound to a detecting enzyme such as horse radish peroxidase. Additional immunological detection systems for TRAC enzymes are now described in detail below.

The term “antibody” as used herein is intended to include fragments thereof which are also specifically reactive with one of the components in the methods and kits of the invention. Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab).sub.2 fragments can be generated by treating an antibody with pepsin. The resulting F(ab).sub.2 fragment can be treated to reduce disulfide bridges to produce Fab fragments. The term “antibody” is further intended to include single chain, bispecific and chimeric molecules. The term “antibody” includes possible use both of monoclonal and polyclonal antibodies (Ab) directed against a target, according to the requirements of the application.

Polyclonal antibodies can be obtained by immunizing animals, for example rabbits or goats, with a purified form of the antigen of interest, or a fragment of the antigen containing at least one antigenic site. Conditions for obtaining optimal immunization of the animal, such as use of a particular immunization schedule, and using adjuvants e.g. Freund’s adjuvant, or immunogenic substituents covalently attached to the antigen, e.g. keyhole limpet hemocyanin, to enhance the yield of antibody titers in serum, are well-known to those in the art. Monoclonal antibodies are prepared by procedures well-known to the skilled artisan, involving obtaining clones of antibody-producing lymphocyte, i.e. cell lines derived from single cell line isolates, from an animal, e.g. a mouse, immunized with an antigen or antigen fragment containing a minimal number of antigenic determinants, and fusing said clone with a myeloma cell line to produce an immortalized high-yielding cell line. Many monoclonal and polyclonal antibody preparations are commercially available, and commercial service companies that offer expertise in purifying antigens, immunizing animals, maintaining and bleeding the animals, purifying sera and IgG fractions, or for selecting and fusing monoclonal antibody producing cell lines, are available.

Specific high affinity binding proteins, that can be used in place of antibodies, can be made according to methods known to those in the art. For example, proteins that bind specific DNA sequences may be engineered (Ladner, R. C., et. al., U.S. Pat. No. 5,096,815), and proteins that bind a variety of other targets, especially protein targets (Ladner, R. C., et. al., U.S. Pat. No. 5,233,409; Ladner, R. C., et. al., U.S. Pat. No. 5,403,484) may be engineered and used in the present invention for covalent linkage to a chelator molecule, so that a complex with a radionuclide may be formed under mild conditions. Antibodies and binding proteins can be incorporated into large scale diagnostic or assay protocols that require immobilizing the compositions of the present invention onto surfaces, for example in multi-well plate assays, or on beads for column purifications.

General techniques to be used in performing various immunoassays are known to those of ordinary skill in the art. Moreover, a general description of these procedures is provided in U.S. Pat. No. 5,051,361 which is incorporated herein by reference, and by procedures known to the skilled artisan, and described in manuals of the art (Ishikawa, E., et. al. (1988), Enzyme Immunoassay Igaku-shoin, Tokyo, NY; Hallow, E. and D. Lane, Antibodies: A Laboratory Manual CSH Press, NY). Examples if several immunoassays are given discussed here.

Radioimrnmunoassays (RIA) utilizing radioactively labeled ligands, for example, antigen directly labeled with .sup.3 H, or .sup.14 C, or .sup.125 I, measure presence of MMP’s as antigenic material. A fixed quantity of labeled MMP antigen competes with unlabeled antigen from the sample for a limited number of antibody binding sites. After the bound complex of labeled antigen-antibody is separated from the unbound (free) antigen, the radioactivity in the bound fraction, or free fraction, or both, is determined in an appropriate radiation counter. The concentration of bound labeled antigen is inversely proportional to the concentration of unlabeled antigen present in the sample. The antibody to MMP can be in solution, and separation of free and bound antigen MMP can be accomplished using agents such as charcoal, or a second antibody specific for the animal species whose immunoglobulin contains the antibody to MMP. Alternatively, antibody to MMP can be attached to the surface of an insoluble material, which in this case, separation of bound and free MMP is performed by appropriate washing.

Immunoradiometric assays (IRMA) are immunoassays in which the antibody reagent is radioactively labeled. An IRMA requires the production of a multivalent MMP conjugate, by techniques such as conjugation to a protein e.g., rabbit serum albumin (RSA). The multivalent MMP conjugate must have at least 2 MMP residues per molecule and the MMP residues must be of sufficient distance apart to allow binding by at least two antibodies to the MMP. For example, in an IRMA the multivalent MMP conjugate can be attached to a solid surface such as a plastic sphere. Unlabeled “sample” MMP and antibody to MMP which is radioactively labeled are added to a test tube containing the multivalent MMP conjugate coated sphere. The MMP in the sample competes with the multivalent MMP conjugate for MMP antibody binding sites. After an appropriate incubation period, the unbound reactants are removed by washing and the amount of radioactivity on the solid phase is determined. The amount of bound radioactive antibody is inversely proportional to the concentration of MMP in the sample.

Other preferred immunoassay techniques use enzyme labels such as horseradish peroxidase, alkaline phosphatase, luciferase, urease, and .beta.-galactosidase. For example, MMP’s conjugated to horseradish peroxidase compete with free sample MMP’s for a limited number of antibody combining sites present on antibodies to MMP attached to a solid surface such as a microtiter plate. The MMP antibodies may be attached to the microtiter plate directly, or indirectly, by first coating the microtiter plate with multivalent MMP conjugates (coating antigens) prepared for example by conjugating MMP with serum proteins such as rabbit serum albumin (RSA). After separation of the bound labeled MMP from the unbound labeled MMP, the enzyme activity in the bound fraction is determined colorimetrically, for example by a multi-well microtiter plate reader, at a fixed period of time after the addition of horseradish peroxidase chromogenic substrate.

Alternatively, the antibody, attached to a surface such as a microtiter plate or polystyrene bead, is incubated with an aliquot of the biological sample. MMP present in the fluid will be bound by the antibody in a manner dependent upon the concentration of MMP and the association constant between the two. After washing, the antibody/MMP complex is incubated with a second antibody specific for a different epitope on MMP distal enough from the MMP-specific antibody binding site such that steric hindrance in binding of two antibodies simultaneously to MMP may be accomplished. For example, the second antibody may be specific for a portion of the proenzyme sequence. The second antibody can be labeled in a manner suitable for detection, such as by radioisotope, a fluorescent compound or a covalently linked enzyme. The amount of labeled secondary antibody bound after washing away unbound secondary antibody is proportional to the amount of MMP present in the biological sample.

The above examples of preferred immunoassays describe the use of radioactively and enzymatically labeled tracers. Assays also may include use of fluorescent materials such as fluorescein and analogs thereof, 5-dimethylaminonaphthalene-1-sulfonyl derivatives, rhodamine and analogs thereof, coumarin analogs, and phycobiliproteins such as allophycocyanin and R-phycoerythrin; phosphorescent materials such as erythrosin and europium; luminescent materials such as luminol and luciferin; and sols such as gold and organic dyes. In one embodiment of the present invention, the biological sample is treated to remove low molecular weight contaminants.

In one embodiment of the present invention, the biological sample is treated to remove low molecular weight contaminants, for example, by dialysis. By the term “dialysis” this invention includes any technique of separating the enzymes in the sample from low molecular weight contaminants. The Examples use Spectra/Por membrane dialysis tubing with a molecular weight cut-off (MWCO) of 3,500, however other products with different MWCO levels are functionally equivalent. Other products include hollow fiber concentration systems consisting of regenerated cellulose fibers (with MWCO of 6,000 or 9,000) for larger volumes; a multiple dialyzer apparatus with a sample size for one to 5 ml; and multiple microdialyzer apparatus, convenient for samples in plates with 96 wells and MWCOs at 5,000, 8,000 and 10,000, for example. These apparatuses are available from PGC Scientific, Gaithersburg, Md., 20898. Those with skill in the art will appreciate the utility of multiple dialysis units, and especially suitable for kits for reference lab and clinic usage. Other equivalent techniques include passage through a column holding a resin or mixture of resins suitable to removal of low molecular weight materials. Resins such as BioGel (BioRad, Hercules, Calif.) and Sepharose (Pharmacia, Piscataway, N.J.) and others are well-known to the skilled artisan. The technique of dialysis, or equivalent techniques with the same function, are intended to remove low molecular weight contaminants from the biological fluids. While not an essential component of the present invention, the step of removal of such contaminants facilitates detection of the disorder-associated enzymes in the biological samples.

The invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all references, pending patent applications and published patents, cited throughout this application are hereby expressly incorporated by reference .

EXAMPLES

The following methodology described in the Materials and Methods section was used throughout these Examples, set forth below.

Material and Methods

Patient Groups

Urine samples were obtained from subjects with clinically-determined cancers of the following types: prostate cancer (13 subjects, Table 1), metastatic cancer (9 subjects, Table 2), and other non-metastatic malignancies in a variety of organs (11 subjects, Table 3). Further, urine samples were obtained from subjects with no history of cancer (13 subjects, Table 4), with benign prostatic hyperplasia (8 subjects Table 5), with no evidence of disease (15 subjects, Table 6), and under treatment by hormonal suppression (4 subjects, Table 7). Urine samples of breast cancer patients were tested for the presence of menstrual blood using Ames Multistix 7 reagent strips (Miles, Elkhardt, Ind.), and those containing blood were not analyzed further. These specimens were analyzed by gelatin zymography, and the results were recorded as positive for each protein band with gelatinase activity observed in the lane corresponding to that urine sample.

Preparation of Samples

Urine samples were kept frozen until assay, thawed overnight at 4 C, and a 10 ml aliquot was dialyzed against double-distilled water in 45 mm dialysis tubing (Spectra/Por membrane MWCO: 3,500, Spectrum, Houston, Tex.). Following dialysis, urine samples were centrifuged at 4,000 rpm for 5 min at 4 C, the supernatant was taken and stored at 4 C prior to analysis. Analysis of urine for enzyme activity was by zymography, comprising gel electrophoresis performed in the presence of enzyme substrate followed by in situ digestion.

Electrophoresis

Polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS) and 0.1% (w/v) gelatin was used in the Examples here. A sample comprising 30 microliters of dialyzed urine was mixed with 15 microliters of sample buffer consisting of 4% SDS, 0.15M Tris pH 6.8, 20% (v/v) glycerol, and 0.5% (w/v) bromphenol blue. Samples were applied to slots in a 4% stacking gel above a 10% polyacrylamide separating gel on a mini-gel slab gel apparatus (Mini-Protein II, Bio-Rad).

Zymography

Following electrophoresis, gels were incubated for 30 min in 2.5% Triton X-100 (v/v) to remove SDS, rinsed, and incubated overnight at 37 C in substrate buffer (0.05M Tris, pH 8.5, 5 mM CaCl.sub.2, 0.02% sodium azide). To visualize bands of active enzyme, gels were stained for protein in 0.5% (w/v) Coomassie Blue R-250 in acetic acid:isopropanol:water (1:3:6), then destained in acetic acid ethanol water (1:3:6). Enzyme activity appeared as clear bands in the dark background, corresponding to the lane for each sample. The electrophoretic mobility of each clear band was determined by correlation with molecular weight protein standards and positive controls (purified mmp-2 and mmp-9 proteins). The molecular weight of each band of active enzyme was recorded according to the following criteria: greater than 150 kDa, 92 kDa, 72 kDa, and other molecular weights (for example, 100 kDa and 20 kDa). The identity of these MMPs was confirmed by western blot analysis using anti-MMP antibodies (Oncogene Sciences, Cambridge, Mass.).

Gels were analyzed by the double blind method, in which reading and scoring the gel patterns was performed by the experimenter without knowledge of the identity of each sample. A band of enzyme activity is indicated by a “yes” in the Tables in the Examples below. Patients with several readings taken from time to time because of possible disease progression are here included only in the grouping of most recent diagnosis, i.e., each coded subject is represented in one Table only.

To verify that enzyme activities observed by zymography detected were metal-dependent proteases, samples were subjected also to incubation in substrate buffer in the presence of 1,10-phenanthroline, an MMP inhibitor.

Normal Controls

Samples of urine from 13 young healthy male subjects revealed 8 positives of 52 possible metalloproteinase bands (15%, Table 1). Thus, 4 of 13 (31%) healthy subjects had detectable gelatinase activity in urine. Analysis of the distribution of the enzyme activity shows that none of the urine samples contained enzyme activity of 72 kDa size.

Table 1. Zymograms of Normal Subjects (13 subjects)

TABLE 1 ______________________________________ Zymograms of Normal Subjects (13 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs ______________________________________ No-1 yes yes no no No-2 no no no no No-3 no no no no No-4 no no no no No-5 no no no no No-6 yes yes no no No-7 no yes no no No-8 yes yes no yes No-9 no no no no No-10 no no no no No-11 no no no no No-12 no no no no No-13 no no no no ______________________________________ Subjects No1 through No13 are normal, and have no medical history of cancer.

Example 1

Enzyme Activity in Urine of Prostate Cancer Patients and Other Cancer Patients

Analysis of urine of CaP patients showed gelatinase in 12 of the 13 samples (Table 2) Thus 92% of urine from CaP patients contained a band of 92 kDa or higher molecular weight, and 48% of the 52 possible zymogram activity categories are positive for the CaP group. These frequencies are over 3-fold higher than comparable findings for the urines from the normal controls.

Urine samples from 5 out of 11 of patients with other types of cancer showed metalloproteinase activity (Table 3). Enzymes were found in urine from 3 out of 5 bladder cancer patients, and in urine from one out of 2 patients with renal cancer, and one out of 2 patients with lymphoma.

Example 2

Enzyme Activity in Urine of Metastatic Cancer Patients

In the MC patient group, urine samples of all 8 patients displayed metalloproteinase activity (Table 4). Of the 32 possible enzyme band categories recorded, 66% were positive for patients with metastatic cancer. Further, the urine of all MC patients contained either enzyme of 92 kDa size, enzyme of molecular weight greater than 150 kDa, or both.

Table 2. Zymograms of Subjects with Prostate Cancer (13 subjects)

TABLE 2 ______________________________________ Zymograms of Subjects with Prostate Cancer (13 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs ______________________________________ CaP-1 yes yes yes no CaP-2 yes yes yes no CaP-3 yes yes yes no CaP-4 yes yes yes no CaP-5 no yes no no CaP-6 no yes no no CaP-7 yes yes no no CaP-8 no yes no no CaP-9 no no no no CaP-10 no yes no no CaP-11 yes yes no no CaP-12 yes yes yes no CaP-13 yes yes no no ______________________________________ Subjects CaP1 through CaP13 are prostate cancer patients.

Table 3. Zymograms of Subjects with Other Cancers, Non-Metastatic (11 subjects)

TABLE 3 ______________________________________ Zymograms of Subjects with Other Cancers, Non-Metastatic (11 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs cancer ______________________________________ CaB-1 no no no no bladder CaB-2 no no no no bladder CaB-3 yes yes no no bladder CaB-4 yes yes yes no bladder CaB-5 yes yes no yes bladder CaR-1 no no no no renal CaR-2 yes yes yes yes renal CaLy-1 no no no no lymphoma CaLy-2 yes yes no no lymphoma CaT-1 no no no no testis CaPh-1 no no no no pheochromo- cytoma ______________________________________ Five subjects with bladder cancer are indicated CaB1 through 5. CaR1 and are subjects with renal cancer. CaLy1 and 2 are subjects with lymphoma, CaT1 is a testicular cancer patient, and CaPH1 has pheochromocytoma.

Table 4. Zymograms of Subjects with Metastatic Cancer (8 subjects)

TABLE 4 ______________________________________ Zymograms of Subjects with Metastatic Cancer (8 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs ______________________________________ Meta-1 yes yes yes no Meta-2 yes yes yes yes Meta-3 yes yes no no Meta-4 yes yes no no Meta-5 yes yes no yes Meta-6 no yes no no Meta-7 yes no no yes Meta-8 yes yes yes yes ______________________________________ Subjects MC1 through 8 are metastatic cancer patients.

Table 5. Zymograms of Subjects with Benign Prostatic Hyperlasia (8 subjects)

TABLE 5 ______________________________________ Zymograms of Subjects with Benign Prostatic Hyperplasia (8 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs ______________________________________ BPH-1 yes yes no no BPH-2 yes yes no no BPH-3 no yes no no BPH-4 no yes no no BPH-5 no yes no no BPH-6 no no no no BPH-7 no no no no BPH-8 yes yes no yes ______________________________________ Subjects indicated BPH1 through 8 have benign prostatic hyperplasia.

Example 3

Enzyme Activity in Urine of Subjects with Benign Prostatic Hypertrophy

Eight subjects with BPH were assayed for metalloproteinase content of urine (Table 5). Of the 32 possible enzyme pattern observations, 10 were positive (31%), and 6 of these 8 patients (75%) had urine containing one or more bands of activity, a frequency higher than that of the normal subjects and those with no evidence of disease. None of the BPH subjects’ urines (0%) showed 72 kDa metalloproteinase band. The MMP pattern of the BPH subjects as a function of time can be used to facilitate prognosis of patients likely to develop problematic BPH or other conditions.

Example 4

Enzyme Activity in Urine of Subjects with No Evidence of Disease

Fifteen subjects with previous medical histories of cancer, with no recent evidence of disease, and under regular clinical observation, were assayed for metalloproteinase content of urine. Three (20%) of the subjects’ urine were found to contain enzyme (Table 6). None of these specimens contained 72 kDa metalloproteinase, and 12% (7 of 60 possible band recordings) of the possible band data from this group were positive. Most of these patients were at one time under treatment for cancer, and have exhibited no symptoms in the recent past and at the time of collection of urine samples. The frequencies of positive results were consistent with that of normal subjects.

Example 5

Enzyme Activity in Urine of Subjects under Hormonal Suppression

Table 7 shows data on metalloproteinase activity pattern in the urine specimens of 4 patients diagnosed with prostate cancer in the past, and currently under treatment by hormonal suppression. Of the 16 possible data entries, one is positive (6%), and thus one of the 4 patients has MMP activity in the urine (25%). The urine enzyme patterns of patients under hormonal suppression, which is used to prevent or delay return of prostate cancer, shows reduced frequency of positive metalloproteinase bands in urine compared to the cancer groups.

Table 6. Zymograms of Subjects with No Evidence of Disease 15 subjects)

TABLE 6 ______________________________________ Zymograms of Subjects with No Evidence of Disease 15 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs ______________________________________ NeD-1 no no no no NeD-2 no no no no NeD-3 no no no no NeD-4 yes yes no no NeD-5 no no no no NeD-6 no no no no NeD-7 no no no no NeD-8 no no no no NeD-9 no no no no NeD-10 no no no no NeD-11 yes yes no no NeD-12 no no no no NeD-13 no no no no NeD-14 yes yes no yes NeD-15 no no no no ______________________________________ NeD-1 through 15 are subjects with prior history of cancer and with no evidence of disease in recent medical history and at the time of the urin sample.

Table 7. Zymograms of Hormonally Suppressed Subjects (4 subjects)

TABLE 7 ______________________________________ Zymograms of Hormonally Suppressed Subjects (4 subjects) enzyme pattern in urine Code >150 kDa 92 kDa 72 kDa other MMPs ______________________________________ HS-1 no no no no HS-2 no no no no HS-3 no no no no HS-4 no yes no no ______________________________________ HS-1, 2, 3 and 4 are subjects with a history of prostate cancer, under treatment by hormonal suppression.

Table 8. Summary of Urine Metalloproteinase Activities in 4 Molecular Weight Categories for All Subjects

TABLE 8 ______________________________________ Summary of Urine Metalloproteinase Activities in 4 Molecular Weight Categories for All Subjects diagnostic category number positive/total percent positive ______________________________________ normal (no cancer history) 8/52 15% prostate cancer, organ confined 25/52 48% other cancers (non-metastatic) 14/43 33% metastatic cancer 21/32 66% benign prostatic hyperplasia 10/32 31% no evidence of disease 7/60 12% hormonal suppression 1/16 6% ______________________________________

Table 9. Summary of 92 kDa Metalloproteinase in Urine

TABLE 9 ______________________________________ Summary of 92 kDa Metalloproteinase in Urine disease status number positive/total percent positive ______________________________________ normal (no cancer history) 4/13 31% prostate cancer, organ confined 12/13 92% other cancers (non-metastatic) 5/11 46% metastatic cancer 7/8 88% benign prostatic hyperplasia 6/8 75% no evidence of disease 3/15 20% hormonal suppression 1/4 25% ______________________________________

These data, for subjects in Examples 1-5 above, are summarized in Table 8 by diagnostic category of the subjects. Table 8 shows that 48% of the categories of metalloproteinase molecular species from urine of subjects with organ-confined prostate cancer, and 66% of those with metastatic cancer, were positive bands of enzyme activity. Controls of urine from normal subjects, from subjects with no evidence of disease, and from hormonally suppressed subjects with a history of prostate cancer, were 15%, 12% and 6%, respectively.

Table 10. Summary of 72 kDa Metalloproteinase Activity in Urine

TABLE 10 ______________________________________ Summary of 72 kDa Metalloproteinase Activity in Urine disease status number positive/total percent positive ______________________________________ normal (no cancer history) 0/13 0% prostate cancer, organ confined 5/13 38% other cancers (non-metastatic) 2/11 18% metastatic cancer 3/8 38% benign prostatic hyperplasia 0/8 0% no evidence of disease 0/15 0% hormonal suppression 0/4 0% ______________________________________

The presence of enzyme activity of 72 kDa MMP in urine (Table 10) is uniquely found in urine from the cancer groups: 38% of subjects with organ-confined prostate cancer (5 of 13) contained this metalloproteinase, compared to none of the subjects in any of the non-cancer groups. The data show that the pattern of presence of particular of full-length metalloproteinase mmp-2 and mmp-9 proenzymes, and of high molecular weight MMPs (greater than 150 kDa), are diagnostic and prognostic tools.

Example 6

Statistical Analysis of Urine MMP Enzyme Patterns in Urine as a Cancer Marker

The urinary MMP pattern data were submitted for statistical analysis using logistic regression, in which prostate and other non-metastatic cancer patients versus the combination of the normal and no evidence of disease (NeD) group is considered the binary outcome.

Comparing normal/NeD versus Cancer, the univariate results of the analysis, for greater than 150 kDa, 92 kDa and 72 kDa MMPs were that a significantly higher proportion of each of these MMP categories was detected in patients with cancer. The “other MMP” category was not significantly different between the cancer group and normal/NeD, i.e., not a significant predictor. Further, the odds are roughly 5 times higher for cancer patients to have MMP of greater than 150 kDa molecular weight detected in the urine compared to normal/NeD (the odds ratio equals 5.38, with a 95% confidence interval of 1.80 to 16.12, likelihood ratio chi-square test is 9.80, probability equals 0.002). The odds of detecting 92 kDa MMP are 7 times greater for the cancer patient group compared to normal/NeD (the odds ratio equals 7.09, with a 95% confidence interval of 4.53 to 40.67, likelihood ratio chi-square test is 13.57, probability less than 0.001). The odds of detecting 72 kDa are estimated to be infinitely higher for those patients with cancer (likelihood ratio chi-square test is 14.07, probability less than 0.001) than the normal/NeD group.

The multivariate analysis establishes the most important MMP markers and controls. The analysis indicates that 92 kDa and 72 kDa MMPs are both significant independent predictors of cancer (probability equals 0.01 for each). An estimate of the probability of cancer for combinations of two independent multivariate predictors is shown in Table 11. Subjects with urinary 72 kDa MMP or with both 92 kDa and 72 kDa MMPs have very high probabilities of having cancer, according to this analysis.

The probabilities of cancer predicted for eight possible combinations of the three univariate predictors are shown in Table 12.

Example 7

Statistical Analysis of Urine MMP Enzyme Pattern as Metastatic Cancer Markers

Statistical methods were used to compare the urinary MMP patterns of subjects from the normal/NeD group versus patients with metastasized cancers (MC). Ninety-five percent confidence limits were derived using Pratt’s method (Blyth, C. R., 1986, J.Am. Stat Assoc. 81: 843-855). For univariate analysis, the results indicate that patients with MC are more likely to have each MMP present in urine compared to normal/NeD. Patients with MC were nearly 13 times more likely to have MMP of greater than 150 molecular weight present in urine than normal/NeD (probability equals 0.002), and 10 times more likely to have 92 kDa MMP (probability equals 0.005) and 72 kDa MMP (probability equals 0.002). A higher proportion of patients with MC compared to subjects in the normal/NeD group had other urinary MMPs (probability equals 0.014).

Using multivariate analysis, the results for MC are that the 92 kDa and 72 kDa MMPs were significant independent predictors (probability less than 0.05 for each). Modeling the estimated probabilities of MC based on the 4 variant combinations of 92 kDa and 72 kDa detected in the urine yielded the data in Table 13.

Table 11. Probability of Cancer Predicted from the Combination of Two Independent Multivariate Predictors, 92 kDa and 72 kDa MMP in Urine

TABLE 11 ______________________________________ Probability of Cancer Predicted from the Combination of Two Independent Multivariate Predictors, 92 kDa and 72 kDa MMP in Urine. 92 kDa 72 kDa Probability of Cancer (%) ______________________________________ – - 34.38 + – 68.18 – + 99.96 + + 99.99 ______________________________________

Table 12. Probability of Cancer Predicted from Urine MMP Pattern Combination of 3 Univariate Predictors

TABLE 12 ______________________________________ Probability of Cancer Predicted from Urine MMP Pattern Combination of 3 Univariate Predictors. 150 kDa 92 kDa 72 kDa Probability of Cancer (%) ______________________________________ – - – 34.53 – - + 99.99 – + – 71.62 + – - 29.69 – + + 99.99 + + – 66.89 + – + 99.95 + + + 99.99 ______________________________________

Table 13. Probability of Metastatic Cancer Predicted from Urine MMP Patter of Two Univariate Predictors

TABLE 13 ______________________________________ Probability of Metastatic Cancer Predicted from Urine MMP Pattern of Two Univariate Predictors. 92 kDa 72 kDa Probability of MC (%) ______________________________________ – - 8.69 + – 36.36 – + 99.94 + + 99.99 ______________________________________

TABLE 14 __________________________________________________________________________ Gelatinase Profile Cancer Type Controls Metalloproteinases Prostate Renal Bladder Breast Other Metastatic NeD Normal __________________________________________________________________________ % with MMP 75 40 80 100 64 90 11 23 hMW 57 30 70 100 64 86 5 18 92 kDa 64 30 70 100 64 81 11 23 72 kDa 39 30 30 10 36 29 0 0 Creatinine (mg/dl): 131 (.+-.70*) 134 (.+-.78.degree.) 91 (.+-.52) 85 (.+-.42) 69 (.+-.38) 97 (.+-.60) 90 (.+-.47) 188 (.+-.76) __________________________________________________________________________ * .+-. standard deviation; hMW = high molecular weight MMP class migratio at greater than or equal to 150 kDa.

Table 15. Statistical Performance Characteristics for Urine MMP Markers*

TABLE 15 ______________________________________ Statistical Performance Characteristics for Urine MMP Markers* positive marker sensitivity (95%CI) specificity (95%CI) LR ______________________________________ Metastatic Cancers hMW 81.0 (58.1, 94.6) 87.8 (73.8, 95.9) 3.4 92 kDa 76.2 (52.8, 91.8) 82.9 (67.9, 92.9) 2.3 72 kDa 28.6 (11.2, 52.2) 100.0 (91.4, 100.0) ND hMW/72 kDa 81.0 (58.1, 94.6) 87.8 (73.8, 95.9) 3.4 Organ-Confined Cancers hMW 53.2 (38.1, 67.9) 87.8 (73.8, 95.9) 5.0 92 kDa 59.6 (44.3, 73.6) 82.9 (67.9, 92.9) 4.0 72 kDa 34.0 (20.9, 49.3) 100.0 (91.4, 100.0) ND 92/72 66.0 (50.7, 79.1) 82.9 (67.9, 92.9 4.4 All Cancers hMW 61.8 (49.2, 73.3) 87.8 (73.8, 95.9) 8.4 92 kDa 64.7 (52.2, 75.9) 82.9 (67.9 92.9) 6.3 72 kDa 67.6 (55.2, 78.5) 100.0 (91.4, 100.0) ND 92/72 70.6 (58.3, 81.0) 82.9 (67.9, 92.9) 6.9 ______________________________________

Example 8

Disease Progression in Cancer Patients and Change in Enzyme Pattern

Patient Meta-4 (Table 4) was originally diagnosed with organ-confined CaP, and was subsequently diagnosed with metastasis, thus the data for this patient appear only in Table 4. Further, urine from patient Meta-6 which displayed 92 kDa MMP as shown, had been assayed 2 months prior to the data for that patient in Table 4, and was negative at that time for all MMP. These individual case histories show the diagnostic and prognostic value for cancer progression of the urine MMP pattern assay. These data showed that there was a high correlation (greater than 99%) of the presence of 72 kDa MMP in urine and presence of cancer.

Example 9

Additional Patient Data

A total of 68 cancer patient urine samples have been collected and analyzed for MMPs by the methods here. These include 28 patients with prostate cancer, 10 with renal cancer, 10 with bladder cancer, 9 with breast cancer, and 11 with other cancer (ovarian, lung, endometrial/cervical, testicular, lelomyosarcoma, adrenal pheochromocytoma, transitional cell carcinoma of kidney and lymphoma). These samples from patients with organ-confined cancers were compared to those from 19 patients with metastatic cancer, 19 former cancer patients with no evidence of disease, and 22 normal volunteers.

MMPs detected in the urine of patients with organ-confined disease and with metastatic cancer were compared to the normal/no evidence of disease control group. Sensitivity and specificity were calculated using standard formulas and expressed as percentages. The likelihood ratio was determined as the fraction of true positives divided by the fraction of false positives (sensitivity/100-specificity) to provide an indicator of the discriminating power for each MMP (Weinstein, M. C. Ed. Clinical Decision Analysis. Philadelphia: Saunders, pp. 84-108, 1980). Stepwise logistic regression was used to establish the independent predictors of cancer and to estimate the probability for combinations of the MMP markers in the final multivariate model. (Breslow, N.E. Statistical methods in cancer research. Volume 1. Lyon, France: Int. Agency for Res. on Cancer, pp. 192 -210, 1980). One-way analysis of variance was performed to assess differences in creatinine levels among the groups with a Bonferroni correction for multiple comparisons. Fisher’s exact test was used for comparison of proportions. All statistical tests were conducted at a two-sided alpha level of 0.05. Data analysis was performed using the SAS for Windows statistical package version 6.11 (SAS Institute Inc., Cary, N.C.).

Results shown in Tables 14 and 15 are consistent with previous data presented herein with smaller samples. Specificity of 72 kDa MMP, for example, in prostatic cancer, all organ-confined cancer and all cancers is found to be 100 at the 95% confidence interval. For all cancers, the positive likelihood ratios (ratio of true positives to false positives) of the high molecular weight (.gtoreq.150 kDA) and 92 kDa MMPs are 8.4 and 6.3, respectively. These results confirm the value of urine MMP zymogram routine analysis to detect the presence of cancer in particular, as an example of a tissue remodelling-associated condition, and for monitoring of cancer patients during therapy, and for prognosis of the course of cancer and the appearance of metastases.

Example 10

A Gelatinase Markerfor Metastatic Breast Cancer

A gelatinase of approximately 125 kDa was detected in the urine of 5 out of 9 specimens obtained from metastatic breast cancer patients. Gelatinase of this size was not observed in urine samples of other subjects.

Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Comments (0)

Methods for therapy of cancer

Filed under: Issued Patent — admin @ 3:25 am

Abstract
Compositions and methods of treating anemia, cancer, AIDS, or severs .beta.-chain hemoglobinopathies by administering a therapeutically effective amount of phenylacetate or pharmaceutically acceptable derivatives thereof or derivatives thereof alone or in combination or in conjunction with other therapeutic agents. Pharmacologically-acceptable salts alone or in combinations and methods of preventing AIDS and malignant conditions, and inducing cell differentiation are also aspects of this invention.

——————————————————————————–
Inventors: Samid; Dvorit (Rockville, MD)
Assignee: The United States of America as represented by the Department of Health (Washington, DC)

Appl. No.: 07/779,744
Filed: October 21, 1991

Government Interests

——————————————————————————–

I. GOVERNMENT INTEREST

The invention described herein may be manufactured, used and licensed by or for the Government for governmental purposes without the payment to us of any royalties thereon.
——————————————————————————–

Claims

——————————————————————————–

What is claimed:

1. A method of inhibiting the growth of a rapidly proliferating nonmalignant or malignant mammalian tumor cell sensitive to a compound recited below in a host in need of such inhibition, comprising administering to the host an amount effective to attain said inhibition of said compound having the formula (I): ##STR9## wherein R and R.sup.1 are independently H, lower alkoxy, or lower alkyl;

R.sup.2 is phenyl, unsubstituted or substituted with halogen, hydroxy, or lower alkyl;

R.sup.3 and R.sup.4 are H; and

n is 0 or 2;

or a pharmaceutically acceptable salt thereof.

2. The method of claim 1, wherein the pharmaceutically acceptable salt is an alkali metal salt or alkaline earth metal salt.

3. The method of claim 1, wherein R is H and R.sup.1 is H, CH.sub.3 O, CH.sub.3, C.sub.2 H.sub.5, or C.sub.3 H.sub.7.

4. The method of claim 1, wherein R is H and R.sup.1 is H.

5. The method of claim 1, wherein R.sup.2 is phenyl or phenyl substituted with from 1 to 4 halogens, from 1 to 4 hydroxy moieties, or from 1 to 2 methyl moieties.

6. The method of claim 1, wherein R.sup.2 is phenyl or phenyl substituted with from 1 to 4 halogens of Cl or F, from 1 to 4 hydroxy moieties, or from 1 to 2 methyl moieties.

7. The method of claim 1, wherein R.sup.2 is phenyl, 3-methylphenyl, 4-methylphenyl, 2,6-dimethylphenyl, 3-chlorophenyl, 4-chlorophenyl, 2,6-dichlorophenyl or 4-fluorophenyl.

8. The method of claim 1, wherein R.sup.2 is phenyl.

9. The method of claim 1, wherein the compound is the sodium salt of phenylacetate, phenylbutyrate, 3-chlorophenylacetate, 4-chlorophenylacetate, 2,6-dichlorophenylacetate, or 4-fluorophenylacetate.

10. The method of claim 1, wherein the compound is the sodium salt of formula I and R is H, R.sup.1 is H, and R.sup.2 is phenyl.

11. The method of claim 1, wherein the compound is sodium phenylacetate.

12. The method of claim 1, wherein the compound is sodium phenylbutyrate.

13. The method of claim 1, wherein n is 0.

14. The method of claim 1, comprising administering a pharmacologically-effective amount of the compound to the host to suppress the growth of the nonmalignant or malignant tumor cell.

15. The method of claim 1, wherein the compound is administered intravenously at a dosage level of from about 50 mg/kg/day to about 1,000 mg/kg/day.

16. The method of claim 1, wherein the compound is administered subcutaneously at a dosage level of from about 50 mg/kg/day to about 1,000 mg/kg/day.

17. The method of claim 1, wherein the compound is administered orally at a dosage level of from about 50 mg/kg/day to about 1,000 mg/kg/day.

18. The method of claim 1, wherein the compound is applied topically at a dosage concentration of from about 1 to about 10 mg/ml.

19. The method of claim 1, wherein the tumor is a prostatic carcinoma tumor, melanoma tumor, glial brain tumor, Kaposi’s sarcoma tumor or lymphoma tumor, leukemic tumor, lung adenocarcinoma tumor, breast cancer tumor, osteosarcoma tumor, fibrosarcoma tumor, or squamous cancer tumor.

20. The method of claim 1, wherein the host is a human.

21. A method of inhibiting the growth of a rapidly proliferating nonmalignant or malignant mammalian tumor cell sensitive to a compound recited below in a host in need of such inhibition, comprising administering to the host an amount effective to attain said inhibition of said compound of phenylacetic acid or phenylbutyric acid or a pharmaceutically acceptable salt thereof.

22. The method of claim 21, wherein the tumor is a prostatic carcinoma tumor, melanoma tumor, glial brain tumor, Kaposi’s sarcoma tumor or lymphoma tumor, leukemic tumor, lung adenocarcinoma tumor, breast cancer tumor, osteosarcoma tumor, fibrosarcoma tumor, or squamous cancer tumor.

23. A method of inhibiting the growth of a rapidly proliferating nonmalignant or malignant mammalian tumor sensitive to a compound recited below in a host in need of said inhibition, consisting essentially of administering to the host an amount effective to attain said inhibition of said compound having the formula (I): ##STR10## wherein R and R.sup.1 are independently H, lower alkoxy, or lower alkyl;

R.sup.2 is phenyl, unsubstituted or substituted with halogen, hydroxy, or lower alkyl;

R.sup.3 and R.sup.4 are H; and

n is 0 or 2;

or a pharmaceutically-acceptable salt thereof.

24. The method of claim 23, wherein the compound is phenylacetic acid or phenylbutyric acid or a pharmaceutically acceptable salt thereof.

25. The method of claim 23, wherein n is 0.

26. The method of claim 23, wherein the tumor is a prostatic carcinoma tumor, melanoma tumor, glial brain tumor, Kaposi’s sarcoma tumor or lymphoma tumor, leukemic tumor, lung adenocarcinoma tumor, breast cancer tumor, osteosarcoma tumor, fibrosarcoma tumor, or squamous cancer tumor.

27. A method of treating a host afflicted with a condition of cancer sensitive to a compound recited below, comprising administering to said host a pharmacological amount effective to ameliorate said condition of said compound having the formula (I): ##STR11## wherein R and R.sup.1 are independently H, lower alkoxy, or lower alkyl;

R.sup.2 is phenyl, unsubstituted or substituted with halogen, hydroxy, or lower alkyl;

R.sup.3 and R.sup.4 are H; and

n is 0 or 2;

or a pharmaceutically-acceptable salt thereof.

28. The method of claim 27, wherein the compound is phenylacetic acid or phenylbutyric acid or a pharmaceutically acceptable salt thereof.

29. The method of claim 27, wherein n is 0.

30. The method of claim 27, wherein the cancer is a prostatic cancer, melanoma, glial brain tumor, Kaposi’s sarcoma or lymphoma, leukemia, lung adenocarcinoma, breast cancer, osteosarcoma, fibrosarcoma, or squamous cancer.

31. A method of inducing differentiation of a tumor cell sensitive to a compound recited below in a host in need of such treatment comprising administering to said host a therapeutically effective amount of said compound having the formula (I): ##STR12## wherein R and R.sup.1 are independently H, lower alkoxy, or lower alkyl;

R.sup.2 is phenyl, unsubstituted or substituted with halogen, hydroxy, or lower alkyl;

R.sup.3 and R.sup.4 are H; and

n is 0 or 2;

or a pharmaceutically-acceptable salt thereof.

32. The method of claim 31, wherein the compound is phenylacetic acid or phenylbutyric acid or a pharmaceutically acceptable salt thereof.

33. The method of claim 31, wherein n is 0.

34. The method of claim 31, wherein the tumor is a prostatic carcinoma tumor, melanoma tumor, glial brain tumor, Kaposi’s sarcoma tumor or lymphoma tumor, leukemic tumor, lung adenocarcinoma tumor, breast cancer tumor, osteosarcoma tumor, fibrosarcoma tumor, or squamous cancer tumor.

35. A method of treating a malignant condition sensitive to a compound recited below in a host in need of such treatment comprising administering to the host a therapeutically effective amount of said compound having the formula (I): ##STR13## wherein R and R.sup.1 are independently H, lower alkoxy, or lower alkyl;

R.sup.2 is phenyl, unsubstituted or substituted with halogen, hydroxy, or lower alkyl;

R.sup.3 and R.sup.4 are H; and

n is 0 or 2;

or a pharmaceutically-acceptable salt thereof.

36. The method of claim 35, wherein the compound is phenylacetic acid or phenylbutyric acid or a pharmaceutically acceptable salt thereof.

37. The method of claim 35, wherein n is 0.

38. The method of claim 35, wherein the malignant condition to be treated is a prostatic cancer, melanoma, glial brain tumor, Kaposi’s sarcoma or lymphoma, leukemia, lung adenocarcinoma, breast cancer, osteosarcoma, fibrosarcoma, or squamous cancer.

39. The method of claim 35, wherein the malignant condition to be treated is prostatic cancer.

40. The method of claim 35, wherein the malignant condition to be treated is melanoma.

41. The method of claim 35, wherein the malignant condition to be treated is a glial brain tumor or Kaposi’s sarcoma or lymphoma.
——————————————————————————–

Description

——————————————————————————–

II. FIELD OF THE INVENTION

This invention relates to methods of using phenylacetic acid and its pharmaceutically acceptable derivatives as antitumor, and antiviral agents, and treatment of severe beta-chain hemoglobinopathies.

III. BACKGROUND OF THE INVENTION

Some of the most dreadful epidemics, inherited diseases and cancerous infections in the history of mankind are afflicting the world’s people at a rapid and discomforting rate. These maladies are being caused in many instances by the increasing cases of cancer, of viral infections, such as human immunodeficiency viruses (HIV) or HTLV and of severe beta-chain hemoglobinopathies. When one pauses to reflect upon the devastating pain, suffering and ultimately death experienced by persons afflicted, these moments of reflection underscore the tremendous importance which must be accorded medical research. In response to the need to alleviate suffering and add comfort to human life, the scientific community throught the world is searching for effective treatments to prevent or ameliorate diseases.

In order to present the enormous scope of this unitary invention in a comprehensive form while preserving the essential need for clarity in presentment, this invention focusing on phenylacetate and its derivatives will be described in the following three (3) subsections, designated herein as A. Phenylacetate In Cancer prevention and maintenance therapy; B. Phenylacetate and its derivatives in the Treatment and Prevention of AIDS; and C. Induction of fetal hemoglobin synthesis in .beta.-chain hemoglobinopathies by phenylacetate and its derivatives.

DESCRIPTION OF RELATED DISCLOSURES

Phenylacetic acid (PAA) is a protein decomposition product found throughout the phylogenetic spectrum, ranging from bacteria to man. Highly conserved in evolution, PAA may play a fundamental role in growth control and differentiation. In plants, PAA serves as a growth hormone (auxin) promoting cell proliferation and enlargement at low doses (10-5-10-7M), while inhibiting growth at higher concentrations. The effect on animal and human cells is less well characterized. In humans, PAA acid is known to conjugate glutamine with subsequent renal excretion of phenylacetylglutamine (PAG). The latter, leading to waste nitrogen excretion, has been the basis for using PAA or preferably its salt sodium phenylacetate (NaPA) in the treatment of hyperammonemia associated with inborn errors of ureagenesis. Clinical experience indicates that acute or long-term treatment with high NaPa doses is well tolerated, essentially free of adverse effects, and effective in removing excess glutamine. [Brusilow, S. W., Horwich, A. L. Urea cycle enzymes. Metabolic Basis of Inherited Diseases, Vol. 6:629-633 (1989)]. These characteristics should be of value in cancer intervention, treatments to inhibit virus replication and treatment of severe beta-chain hemoglobinopathies.

Glutamine is the major nitrogen source for nucleic acid and protein synthesis, and substrate for energy in rapidly dividing normal and tumor cells. Compared with normal tissues, most tumors, due to decreased synthesis of glutamine along with accelerated utilization and catabolism, operate at limiting levels of glutamine availability, and consequently are sensitive to further glutamine depletion. Considering the imbalance in glutamine metabolism in tumor cells and the ability of PAA to remove glutamine, PAA has been proposed as a potential antitumor agent, however, no data was provided to substantiate this proposal. [Neish, W. J. P. "Phenylacetic Acid as a Potential Therapeutic Agent for the Treatment of Human Cancer", Experentia, Vol. 27, pp. 860-861 (1971)].

Despite efforts to fight cancer, many malignant diseases that are of interest in this application still present a major challenge to clinical oncology. Prostate cancer, for example, is the second most common cause of cancer deaths in men. Current treatment protocols rely primarily on hormonal manipulations, however, in spite of initial high response rates, patients often develop hormone-refractory tumors, leading to rapid disease progression with poor prognosis. Overall, the results of cytotoxic chemotherapy have been disappointing, indicating a long felt need for new approaches to treatment of advanced prostatic cancer. Other diseases resulting from abnormal cell replication for example, metastatic melanomas, brain tumors of glial origin (e.g., astrocytomas), and lung adenocarcinoma, are all highly aggressive malignancies with poor prognosis. The incidence of melanoma and lung adenocarcinoma has been increasing significantly in recent years. Surgical treatment of brain tumors often fails to remove all tumor tissues, resulting in recurrences. Systemic chemotherapy is hindered by blood barriers. Therefore there is an urgent need for new approaches to the treatment of human malignancies such as advanced prostatic cancer, melanoma, brain tumors, and others.

The development of the methods of the present invention was guided by the hypothesis that metabolic traits that distinguish tumors from normal cells could potentially serve as targets for therapeutic intervention. Tumor cells show unique requirements for specific amino acids, of which glutamine would be the desired choice because of its major contribution to energy metabolism and to synthesis of purines, pyrimidines, and proteins. Along this line, promising antineoplastic activities have been demonstrated with glutamine-depleting enzymes such as glutaminase, and various glutamine antimetabolites, unfortunately, the clinical usefulness of these drugs has been limited by unacceptable toxicities. Consequently, the present invention focuses on PAA, a plasma component known to conjugate glutamine in vivo.

In addition to its effect on glutamine phenylacetate can induce tumor cells to undergo differentiation. (See examples 1-5, 8 and 9 herein) Differentiation therapy is a known desirable approach to cancer intervention. The underlying hypothesis is that neoplastic transformation results from defects in cellular differentiation. Inducing tumor cells to differentiate would prevent tumor progression and bring about reversal of malignancy. Several differentiation agents are known, but their clinical applications have been hindered by unacceptable toxicities and/or deleterious side effects.

Accordingly, a major object of the present invention is to provide a method for treating various cancerous conditions with PAA and its pharmaceutically acceptable salts and derivatives.

Another object of the present invention is to provide a method for the prevention of tumor progression and the development of malignant conditions in high risk individuals by administering prophylactically effective amounts of nontoxic agents such as phenylacetate and its pharmaceutically acceptable derivatives.

Another object of the present invention is to provide a method for the amelioration of and prophlactic treatment against viral infections. Still another object of the present invention is to provide a method for the amelioration of and prophylactic treatment against severe anemia associated with beta-chain hemoglobinopathies.

It is yet a further object to provide a method of treating or preventing the onset of malignancies, viral infections associated with AIDS or severe beta-chain hemoglobinopathies with a combination of Phenylacetate (or its pharmaceutically acceptable derivatives) and various other therapeutic or preventive agents alone or in conjunction with conventional therapies.

A further object of the invention is to provide effective pharmaceutical formulations of PAA and its pharmaceutically acceptable derivatives for carrying out the above methods.

IV. BRIEF SUMMARY OF THE INVENTION

The present invention is directed to methods for therapy of cancer. The methods relate to administering a compound or salt of a compound having the formula (I).

The present invention provides a method of (1) suppressing the growth of tumor cells in a host in need of such suppression comprising administering an amount of PAA or a pharmaceutically acceptable derivative thereof effective to suppress the growth of said tumor cells and (2) preventing the onset of or ameliorating the effects of viral infections or severe beta-chain hemoglobinopathies.

For the purpose of the present application, the PAA derivatives include its pharmacological acceptable salts, preferably sodium; analogs containing halogen substitutions, preferably chlorine or fluorine; analogs containing alkyl substitutions, preferably methyl or methoxy; precursors of phenylacetate, preferably phenylbutyrate; and natural analogs such as naphtylacetate.

The compounds of the present invention can be administered intravenously, enterally, parentally, intramuscularly, intranasally, subcutaneously, topically or orally. The dosage amounts are based on the effective inhibitory concentrations observed in vitro and in vivo in antitumorigenicity studies. The varied and efficacious utility of the compounds of the present invention is further illustrated by the finds that they may also be administered concomitantly or in combination with other antitumor agents such as hydroxyurea, 5-azacytidin, 5-aza-2′ deoxycytidine, suramin; retinoids; hormones; biological response modifiers, such as interferon and hematopoetic growth factors; and conventional chemo- and radiation therapy or various combinations thereof.

The present invention also provides methods of inducing tumor cell differentiation in a host comprising administering to the host a therapeutically effective amount of PAA or a pharmaceutically acceptable derivative thereof.

The present invention also provides methods of preventing the formation of malignancies by administering to a host a prophylactically effective amount of PAA or a pharmaceutically acceptable derivative thereof.

The present invention also provides methods of treating malignant conditions, such as prostatic cancer, melanoma, adult and pediatric tumors, e.g. brain tumors of glial origin, astrocytoma, Kaposi’s sarcoma, lung adenocarcinoma and leukemias, as well as hyperplastic lesions, e.g. benign hyperplastic prostate and papillomas by administering a therapeutically effective amount of PAA or a pharmaceutically acceptable derivative thereof.

V. BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the inhibition of HL-60 leukemia and permalignant 10T1/2 cell proliferation by NaPA.

FIG. 2 shows the induction of HL-60 cell differentiation. The number of NBT positive cells was determined after 4 or 7 days of treatment. NaPA (h), 1.6 mg/ml; NaPA (1), 0.8 mg/ml. 4-hydroxy PA and PAG were used at 1.6 mg/ml. Potentiation by RA 10 nM was comparable to that by IFN gamma 300 IU/ml, and the effect of acivicin 3 ug/ml similar to DON 30 ug/ml. Glutamine Starvation (Gln, <0.06 mM) was as described (18). Cell viability was over 95% in all cases, except for DON and acivicin (75% and 63%, respectively).

FIG. 3 shows adipocyte conversion in 10T1/2 cultures. Lipids stained with Oil-Red O were extracted with butanol, and the optical density at 510 nm determined. Increased lipid accumulation was evident with NaPA concentrations as low as 0.024 mg/ml.

FIG. 4 shows the effect of NaPA on cell proliferation. PC3; DU145; LNCap; and, FS4 cultures were treated with NaPA or PAG for four days.

FIG. 5 shows the inhibition of tumor cell invasion by NaPA cells treated in culture for 7 days were harvested and assayed for their invasive properties using a modified Boyder Chamber with a matrigel-coated filter. Results scored 6-24 hours later.

VI. DETAILED DESCRIPTION OF THE INVENTION

According to the present invention, PAA, in particular its sodium salt NaPA has been found to be an excellent inhibitor of the growth of specific tumor cells, affecting the proliferation of the malignant cells while sparing normal tissues. Also, according to the present invention, NaPA has been found to induce tumor cell differentiation, thus offering a most desirable approach to cancer prevention and therapy. Additionally, NaPA has been found to be of potential value for the treatment of AIDS and severe beta-chain hemoglobino-pathies. The exact mechanisms by which the compounds used in the method of this invention exert their effect is uncertain, one mechanism may involve depletion of plasma glutamine. Based on the data reported herein, it is believed that glutamine depletion alone cannot explain the molecular and phenotypic changes observed in vitro following exposure to NaPA. It will be understood, however, that the present invention is not to be limited by any theoretical basis for the observed results. Most significantly, it has now been discovered for the first time:

1. A pharmacetical composition for inhibiting (1) abnormal cell growth and inducing differentiation in nonmalignant or malignant mammalian tumor cells; (2) altering gene expression and inducing differentiation in nonmalignant mammalian cells; or (3) viral replication and spread, comprising a pharmacologically-effective amount of a compound of the formula ##STR1## wherein

R and R.sup.1 is H, lower alkoxy, or lower alkyl; R.sup.2 =aryl and substituted aryl; stereoisomers thereof, pharmaceutically-acceptable derivatives or salts thereof; and mixtures thereof.

2. The composition of claim 1, wherein the pharmaceutically-acceptable salts are selected from the group consisting of a alkali and alkaline earth metal.

3. The composition of claim 1, wherein the pharmaceutically-acceptable salt is an alkali metal.

4. The composition of claim 3, wherein the alkalimetal is sodium.

5. The composition of claim 1, wherein R is H and R.sup.1 is H, CH.sub.3, CH.sub.3 --O--, C.sub.2 H.sub.5, or C.sub.3 H.sub.7.

6. The composition of claim 5 wherein R.sup.2 is ##STR2## X is halogen or hydroxy; and n is 0 to 4.

7. The composition of claim 6, wherein X is Cl, F, or hydroxy.

8. The composition of claim 7, wherein X is Cl.

9. The composition of claim 8, wherein R.sup.2 is ##STR3##

10. The composition of claim 9, wherein R is H or C.sub.3 H.sub.7 and R.sup.1 is H.

11. The composition of claim 10, wherein R.sup.2 is ##STR4##

12. The composition of claim 11, wherein R.sup.2 is ##STR5## and R is hydrogen.

13. The composition of claim 11 wherein R.sup.2 is ##STR6## and R is C.sub.3 H.sub.7.

14. The composition of claim 11, wherein R.sup.2 is ##STR7##

15. The composition of claim 11, wherein R.sup.2 is ##STR8##

16. The composition of claim 1, comprising about 0.010 to 99.990 weight percent (%) of said compound.

17. A method of inhibiting the growth of rapidly proliferating nonmalignant and malignant mammalian tumor cells, comprising administering to a host in need of said inhibition an amount of the composition of claim 1 effective to attain said inhibition.

18. A method of inhibiting the altering gene expression and inducing differentiating in nonmalignant or malignant mammalian tumor cells in red blood derived from a patient afflicted anemia resulting from abnormal hemoglobin production, comprising administering to host in need of inhibition an inhibitory amount of the composition of claim 1 effective to attain said inhibition.

19. The method of inhibiting viral replication and spread of virus-infected abnormal mammalian cells, comprising administering to a host in need of said inhibition an amount of the composition of claim 1 effective to attain said inhibition.

20. The method of claim 17, wherein said abnormal mammlian cells are red blood derived from a patient afflicted with anemia resulting from abnormal production adult-form hemoglobin.

21. The method of claim 18, wherein the anemic cells are selected from the group comprising sickle cell anemia or beta-thalassemia.

22. The method of claim 19, wherein the virus-infected cell is infected with a retrovirus.

23. The method of claim 22, wherein the retrovirus is a Human Immunodeficiency Virus or HTLV.

24. The method of claim 17, wherein the composition is prophylactically administered prior to the onset of malignancy.

25. The method of claim 24, wherein the composition is prophylactically administered prior to the onset of AID or AIDS-Associated disorders.

26. A method of treating a host afflicted with a condition of cancer, anemia, HIV or HTLV comprising administering to said host a pharmacological amount of the composition of claim 1 effective to ameliorate said conditions.

27. The method in accordance with claim 17 comprising administering to said host an amount of phenylacetic acid or a pharmaceutically acceptable derivative or salt thereof a pharmacologically-effective to suppress the growth of beneign or malignant tumor cells.

28. The method in accordance with claim 18 comprising administering to said host an amount of phenylacetate derivative or salt thereof a pharmalogically-effective to induce the production of the fetal-form hemoglobin.

29. The method according to claim 26, wherein phenylacetic acid or a pharmaceutically acceptable derivative thereof is administered intravenously at a dosage level of from about 50 mg/kg/day to about 100 mg/kg/day.

30. The method according to claim 26, wherein phenylacetic acid or a pharmaceutically acceptable derivative thereof is administered subcutaneously at a dosage level of from about 50 mg/kg/day to about 1000 mg/kg/day.

31. The method according to claim 26, wherein, phenylacetic acid or a pharmaceutically acceptable derivative thereof is administered orally at a dosage level of from about 50 mg/kg/day to about 1000 mg/kg/day.

32. The method according to claim 26, wherein phenylacetic acid or a pharmaceutically acceptable derivative thereof is applied topically at a dosage concentration to about 1 to 10 mg/ml.

33. The method according to claim 26, wherein phenylacetic acid or a pharmaceutically acceptable derivative thereof is administered concomitantly or in combination with an antitumor or antiviral agent.

34. The method according to claim 27, wherein phenylacetic acid or a pharmaceutically acceptable derivative thereof is administered concomitantly or in combination with a biological response modifier.

35. The method according to claim 33, wherein the antitumor agent is selected from the group consisting of hydroxyurea, suramin, retinoids 5-azacytidine and 5-aza-2-deoxcytidine.

36. The method according to claim 33, wherein the the antiviral agent is AZT or DDI.

37. The method according to claim 34, wherein the biological response modifier is selected from the group consisting of interferons, hormones, hormone-antagonists.

38. The method according to claim 26, wherein phenylacetic acid or a pharmaceutically acceptable derivative therof is administered concomitantly or in combination with conventional biotherapy, chemotherapy, hormone manipulation, or radiation therapy.

39. The method according to claim 26, wherein the pharmaceutically acceptable derivative is sodium phenylacetate.

40. The method according to claim 26, wherein the pharmaceutically acceptable derivative is sodium phenylbutyrate.

41. A method of inducing tumor cell differentiation in a host in need of such treatment comprising administering to said host a therapeutically effective amount of phenylacetic acid or a pharmaceutically acceptable derivative thereof.

42. The method according to claim 41, wherein the anemia is sickle cell or beta-thalassemia.

43. A method of treating malignant conditions comprising administering to a host in need of such treatment a therapeutically effective amount of phenylacetic acid or a pharmaceutically acceptable derivative thereof.

44. A method according to claim 43, wherein the malignant condition to be treated comprises prostatic, melanoma, glial brain tumor, AIDS-Associated Kaposi's Sarcoma and Lymphomas, leukemia, lung adenocarcenoma, brest cancer, osteosarcoma, fibrosarcoma, and squamous cancers.

45. The method of claim 44 provided that R.sup.11 cannot be phenyl when the condition being treated is brest cancer.

46. The method according to claim 43, wherein the malignant condition to be treated is prostatic cancer.

47. The method according to claim 43, wherein the malignant condition to be treated is melanoma.

48. The method of claim 43 wherein the malignant condition being treated is selected from the group consisting essential of glial brain tumors, AIDS and AIDS associated klaposi's sarcoma and lyphomas.2

VII. EXAMPLES

The herein offered examples, including experiments, provide methods for illustrating, without any implied limitation, the practice of this invention focusing on phenylacetate and its derivatives directed to A. Cancer therapy and prevention; B. Treatment and prevention of AIDS; and C. Induction of fetal hemoglobin synthesis in .beta.-chain hemoglobinopathies.

SECTION A.

PHENYLACETATE IN CANCER PREVENTION AND MAINTENANCE THERAPY

Recent advances in molecular techniques allow the detection of genetic disorders associated with predisposition to cancer. Consequently, it is now possible to identify high-risk individuals as well as patients in remission with residual disease. Despite such remarkable capabilities, there is no acceptable preventive treatment. Chemopreventive drugs are needed also for adjuvant therapy, to minimize the carcinogenic effects of the prevailing anticancer agents and maintain tumor responses.

To qualify for use in chemoprevention, a drug should have antitumor activities, be nontoxic and well tolerated by humans, easy to administer (orally), and inexpensive. We suggest that NaPA may possess all of the above characteristics.

Experimental Data

1. Prevention of Neoplastic transformation--Oncogene transfer studies.

NIH 3T3 cells carrying activated EJras oncogene (originally isolated from human bladder carcinoma) were used as a model to study the potential benefit of NaPA treatment to high risk individuals, in which predisposition is associated with oncogene activation. Cell treatment with NaPA was initiated 24-48 hr after oncogene transfer. Results, scored 14-21 days later, showed dose-dependent reduction in the formation of ras-transformed foci in cultures treated with NaPA. Molecular analyses indicated that the drug did not interfere with oncogene uptake and transcription, but rather prevented the process of neoplastic transformation. The effect was reversible upon cessation of treatment. In treated humans, however, the fate of the premalignant cells may be substantially different due to involvement of humoral and cellular immunity (see below).

2. Prevention of tumor progression by genotoxic chemotherapy

Current approaches to combat cancer rely primarily on the use of chemicals and radiation, which are themselves carcinogenic and may promote recurrences and the development of metastatic disease. One example is the chemotherapeutic drug 5-aza-2' deoxycytidine (5Azadc). While this drug shows promise in treatment of some leukemias and severe inborn anemias, the clinical applications have been hindered by concerns regarding toxicity and carcinogenic effects. Our data indicate that NaPA can prevent tumor progression induced by 5azadC.

The experimental model involved non malignant 4C8a10 cells (revertants of Ha-ras-transformed NIH3T3 fibroblasts). Transient treatment of the premalignant cells with 5AzadC resulted in malignant conversion evident within 2 days, as determined by cell morphology, loss of contact inhibition and anchorage dependent growth in culture, acquired invasive properties and tumorigenicity in recipient athymic mice. Remarkably, NaPA prevented the development of the malignant phenotype in the 5AzadC treated cultures.

TABLE 1 ______________________________________ Tumor Formation.sup.a Growth Treatment Incidence Size (mm) on matrigel.sup.b ______________________________________ None 3/8 1 (0.5-2) - 5Azadc (0.1 uM) 8/8 11.5 (4-19) + NaPA (1.5 mg/ml) 0/8 - 5Azadc + NaPA (0.1 uM) (1.5 mg/ml) 0/8 0 - ______________________________________ .sup.a Cells pretreated in culture were injected s.c. (5x10.sup.5 cells per site) into 3 month old female athymic nude mice (Division of Cancer Treatment, NCI animal Program, Frederick Cancer Research Facility). Results indicate the incidence (tumor bearing/injected animals), as well as tumor size as mean (range), determined after 3 weeks. .sup.b Cells were plated on top of matrigel (reconstituted basement membrane) and observed for malignant growth pattern, i.e., active replication, development of characteristic processes, and invasion.

Anticipated Activity in Humans.

In terms of cancer prevention, the beneficial effect of NaPA humans may be even more dramatic than that observed with the experimental models. In humans, NaPA is known to deplete circulating glutamine, an aminoacid critical for the development and progression of cancer. The enzymatic reaction leading to glutamine depletion takes place in the liver and kidney; it is not clear whether or not glutamine depletion occurs in the cultured tumor cells. Moreover, molecular analysis revealed that NaPA can induce the expression of histocompatibility class I antigens, which are localized on the surface of tumor cells and affect the immune responses of the host. While the therapeutic benefit of NaPA observed in cultures is in some cases reversible upon cessation of treatment, in patients the tumor cells might eventually be eliminated by the immune system. Even if chemoprevention will require continuous treatment with NaPA, this would be acceptable considering the lack of toxicity.

Pharmaceutical compositions containing phenylacelate have been shown to cause reversal of malignancy and to induce differenciation of tumor cells. To demonstrate the capacity of drugs to induce differentiation of tumor cells, three in vitro differentiation model systems were used. (See sections A and D herein) The first system used a human promyelocytic leukemia cell line HL-60. This cell line represents uncommitted precursor cells that can be induced to terminally differentiate along the myeloid or monocytic lineage. In the second system, immortalized embryonic mesenchymal C3H 10T1/2 cells were used which have the capabilities of differentiating into myocytes, adipocytes, or chondrocytes. In the third system, human erythroleukemia cells (K562) were used which can be induced to produce hemoglobin.

EXAMPLE 1

Referring now to the data obtained using the first system, the results of which are illustrated in FIG. 1, logarithmically growing HL-60 [--.largecircle.--] and 10T1/2 [--.largecircle.--] cells were treated for four days with NaPA [++] or phenylacetylglutamate (PAG) [- - -]. The adherent cells were detached with trypsin/EDTA and the cell number determined using a hemocytometer. Data points indicate the mean.+-.S.D. of duplicates from two independent experiments. The cell lines were obtained from the American Type Culture Collection and maintained in RPMI 1640 (HL-60) or Dulbecco's Modified Eagle's Medium (10T1/2) supplemented with 10% heat inactivated fetal calf serum (Gibco Laboratories), 2 mM L-Glutamine, and antibiotics. PAA (Sigma, St. Louis Mo.) and PAG were each dissolved in distilled water, brought to pH 7.0 by the addition of NaOH, and stored in -20.degree. C. until used. As demonstrated in FIG. 1, NaPA treatment of the HL-60 and 10T1/2 cultures was associated with dose dependent inhibition of cell proliferation.

EXAMPLE 2

To further evaluate the effectiveness of NaPA as an inducer of tumor cell differentiation, the ability of NaPA to induce granulocyte differentiation in HL-60 was investigated. The ability of cells to reduce nitroblue tetrazolium (NBT) is indicative of oxidase activity which is characteristic of the more mature forms of human bone marrow granulocytes. NBT reduction thus serves as an indicator of granulocyte differentiation. In FIG. 2, the number of NBT positive cells was determined after 4 days [solid bars] or 7 days [hatched bar] of treatment. NaPA (h), 1.6 mg/ml; NaPA (1), 0.8 mg/ml. 4-hydroxyphenylacetate (4HPA) and PAG were used at 1.6 mg/ml. Potentiation by retinoic acid (RA) 10 nM was comparable to that by interferon gamma 300 IU/ml. The direction of differentiation towards granulocytes in cultures treated with NaPA, whether used alone or in combination with RA, was confirmed by microscopic evaluation of cells stained with Wright Stain and the lack of nonspecific esterase activity. The effect of acivicin (ACV) 1 ug/ml was similar to 6-diazo-5-oxo-L-norleucine (DON) 25 ug/ml. Glutamine starvation (Gln, <0.06 mM) was as described. Cell viability determined by trypan blue exclusion was over 95% in all cases, except for DON and ACV which were 75% and 63%, respectively. DON, ACV and HPA are glutamine antagonists. As illustrated in FIG. 2, it is clear that NaPA is capable of inducing granulocyte differentiation in HL-60. As further illustrated in FIG. 2, differentiation of HL-60, assessed morphologically and functionally, was sequential and could be further enhanced by the addition of low doses of retinoic acid (RA, 10 nM) or interferon gamma (300 IU/ml). After seven days of NaPA treatment, or four days, when combined with RA, the HL-60 cultures were composed of early stage myelocytes and metamyelocytes (30-50%), as well as banded and segmented neutrophils (30-40%) capable of NBT.

Pharmacokinetics studies in children with urea cycle disorders indicate that infusion of NaPA 300-500 mg/kg/day, a well tolerated treatment, results in plasma levels of approximately 800 ug/ml. Brusilow, S. W. et al. Treatment of episodic hyperammonemia in children with inborn errors of urea synthesis. The New England Journal of Medicine. 310:1630-1634 (1984). This same concentration was shown to effectively induce tumor cell differentiation in the present experimental system.

EXAMPLE 3

That NaPA is capable of inducing adipocyte conversion in 10T1/2 cultures is illustrated in FIG. 3. The results in FIG. 3 show that differentiation was dose and time-dependent, and apparently irreversible upon cessation of treatment. NaPA at 800 ug/ml was quite efficient and totally free of cytotoxic effect. In the 10T1/2 model, adipocyte conversion involved over 80% of the cell population. It was noted that higher drug concentrations further increased the efficiency of differentiation as well as the size of lipid droplets in each cell.

It is known that glutamine conjugation by NaPA is limited to humans and higher primates and that in rodents NaPA binds glycine. [James, M. O. et al. The conjugation of phenylacetic acid in man, sub-human primates and some nonprimate species. Proc. R. Soc. Lond. B. 182:25-35 (1972). Consequently, the effect of NaPA on the mouse 10T1/2 cell line could not be explained by an effect on glutamine. In agreement, neither glutamine starvation nor by treatment with glutamine antagonists such as DON and ACV resulted in adipocyte conversion.

EXAMPLE 4

TABLE 2 ______________________________________ Phenylacetate and Derivatives: Induction of cellular differentiation in premalignant 10T1/2 cells Compounds DC50* Differentiation (sodium salts) at 1 mM (mM) (%) ______________________________________ Phenylacetate 65 0.7 1-naphthylacetate >95 <0.1 3-chlorophenylacetate 80 0.5 4-chlorophenylacetate 50 1.0 2,6-dichlorophenylacetate 75 0.5 4-fluorophenylaceatae 65 0.7 ______________________________________ *DC50, concentration of compound causing 50% differentiation

Potential clinical use of phenylacetate and derivatives

As shown in the table, phenylacetate and its derivatives efficiently induced lipid accumulation and adipocyte (fat cell) differentiation in premalignant cells. This and other results indicate that the tested compounds might be of value in:

1. Cancer prevention. Non replicating, differentiated tumor cells are not likely to progress to malignancy.

2. Differentiation therapy of malignant and phathological nonmalignant conditions.

3. Treatment of lipid disorders, in which patients would benifit from increased lipid accumulation.

4. Wound healing. This is indicated by the ability of phenylacetate to induce collagen synthesis in fibroblasts (shown in FIG. 13).

It is known that studies in plants reveal that NaPA can interact with intracellular regulatory proteins and modulate cellular RNA levels. In an attempt to explore the possible mechanism of action, Northern blot analysis of HL-60 and 10T1/2 cells was performed according to conventional methods. As shown in FIG. 4a, cytoplasmic RNA was extracted, separated and analyzed (20 .ltoreq.g/lane) from confluent cultures treated for 72 hrs with NaPA or PAG (mg/ml); C is the untreated control. The aP2 cDNA probe was labeled with [32P]dCTP (NEN) using a commercially available random primed DNA labeling kit. Ethidium bromide-stained 28S rRNA indicates the relative amounts of total RNA in each lane.

The results of the Northern blot analysis of HL-60 and 10T1/2 cells, showed marked changes in gene expression shortly after NaPA treatment. Expression of the adipocyte-specific aP2 gene was induced within 24 hrs in treated 10T1/2 confluent cultures reaching maximal mRNA levels by 72 hrs.

EXAMPLE 5

In HL-60, cell transformation has been linked to myc amplification and overexpression, and differentiation would typically require down regulation of myc expression. [Collins, S. J. The HL-60 promyelocytic leukemia cell line: Proliferation, differentiation, and cellular oncogene expression. Blood. 70:1233-1244 (1987)]. To demonstrate the kinetics of myc inhibition and HLA-A induction, Northern blot analysis of cytoplasmic RNA (20 ug/lane) was carried out on cells treated with NaPA and PAG for specified durations of time and untreated controls (-). Two concentrations of NaPA, 1.6 mg/ml (++) and 0.8 mg/ml (+), and PAG at 1.6 mg/ml was investigated. The 32P-labeled probes used were myc 3rd exon (Oncor) and HLA-A3 Hind III/EcoRI fragment. NaPA caused a rapid decline in the amounts of myc mRNA. This occurred within 4 hours of treatment, preceding the phenotypic changes detectable by 48 hrs, approximately two cell cycles, after treatment. Similar kinetics of myc inhibition have been reported for other differentiation agents such as dimethyl sulfoxide, sodium butyrate, bromodeoxyuridine, retinoids, and 1,25-dihydroxyvitamin D3. The results suggest that down regulation of oncogene expression by NaPA may be responsible in part for the growth arrest and induction of terminal differentiation. In addition, NaPA treatment of the leukemic cells was associated with time- and dose-dependent accumulation of HLA-A mRNA coding for class I major histocompatibility antigens. It is believed that this may enhance the immunogenicity of tumors in vivo.

EXAMPLE 6

Further support for the use of NaPA as a non-toxic inducer of tumor cell differentiation was found in the ability of NaPA to promote hemoglobin biosynthesis in erythroleukemia cells. It is known that K562 leukemic cells have a nonfunctional betta globin gene and, therefore, do not normally make much hemoglobin. When K562 human erythroleukemia cells were grown in the presence of NaPA at 0.8 and 1.6 mg/ml concentrations, hemoglobin accumulation, a marker of differentiation, was found to increase 4-9 fold over the control cells grown in the absence of NaPA. Hemoglobin accumulation was determined by Benzidine staining of cells for hemoglobin and direct quantitation of the protein.

It has been shown that high concentrations of NaPA inhibit DNA methylation in plants. [Vanjusin, B. J. et al. Biochemia 1,46:47-53 (1981)]. Alterations in DNA methylation can promote oncogenesis in the evolution of cells with metastatic capabilities. [Rimoldi, D. et al. Cancer Research. 51:1-7 (1991)]. These observations raised some concerns regarding potential long-term adverse effects with the use of NaPA. To determine the potential tumorigenicity of NaPA, a comparative analysis was performed using NaPA and a known hypomethylating agent 5-aza-2'-deoxycytidine (5AzadC).

Premalignant cells (3-4.times.105) were plated in 75 cm2 dishes and 5AzadC 0.1 uM was added to the growth medium at 20 and 48 hrs after plating. The cells were then subcultured in the absence of the nucleoside analog for an additional seven weeks. Cells treated with NaPA at 1.6 mg/ml were subcultured in the continuous presence of the drug. For the tumorigenicity assay, 4-5 week-old female athymic nude mice were inoculated s.c. with 1.times.106 cells and observed for tumor growth at the site of injection.

The results set forth in Table 1 show that NaPA, unlike the cytosine analog, did not cause tumor progression.

TABLE 3 ______________________________________ Tumorigenicity of C3H 10T1/2 Cells in Athymic Mice Tumors Treatment Incidence Time (positive/ Diameter (weeks) injected mice) (mm .+-. - S.D.) ______________________________________ None 0/8 0 5 AzadC 8/8 5.5 .+-. 2.5 NaPA 0/8 0 ______________________________________

The transient treatment of actively growing 10T1/2 cells with 5AzadC resulted in the development of foci of neoplastically transformed cells with a frequency of about 7.times.10-4. These foci eventually became capable of tumor formation in athymic mice. By contrast, actively replicating 10T1/2 cultures treated for seven weeks with NaPA, 800-1600 ug/ml, differentiated solely into adipocytes, forming neither neoplastic foci in vitro nor tumors in recipient mice.

Furthermore, experiments have demonstrated that NaPA can prevent spontaneous or 5AzadC-induced neoplastic transformation, thus suggesting a potential role in cancer prevention. It is known that the treatment of premalignant 4C8 and 10T1/2 cells with carcinogens such as 5AzadC produces malignant conversion of the respective cells. When 4C8 [Remold: et al., Cancer Research, 51:1-7 (1990)] and 10T1/2 cells were exposed to 5AzadC, malignant conversion was evident in two days and two weeks, respectively. NaPA (0.8-1.6 mg/ml) prevented the appearance of the malignant phenotype, as determined by cell morphology, contact inhibition and anchorage dependent growth in culture. Additionally, see section B, herein.

EXAMPLE 7

The K562 erythroleukemia line serves as a model for inherited anemias that are associated with a genetic defect in the beta globin gene leading to severe B-chain hemoglobinopathies.

The results reported in Table 3 also show that there is a synergistic affect when leukemia cells are exposed NaPA in combinaiton with interferon alpha, a known biological response modifier or with the chemotherapeutic drug hydroxyurea (HU).

TABLE 4 ______________________________________ Induction of Hemoglobin Synthesis in Erythroleukemia K562 cells BENZIDINE CELL POSITIVE VIABILITY TREATMENT CELLS* (%) (%) ______________________________________ Control 1.8 >95 NaPA 0.8 mg/ 6.0 1.6 mg/ml 17.1 Interferon 500 IU/ml 13.5 HU 100 uM 17.2 NaPA (0.8 mg/ml) + HU or IFN 40-42 ______________________________________ *Results at seven days of treatment.

Analysis of gene transcripts showed accumulation of mRNA coding for gamma globin, the fetal form of globin. This was confirmed at the protein level.

Using the erythroleukemia K562 cell line described above it was found that 4 hydroxyphenylacetate was as effective as NaPA in inducing fetal hemoglobin accumulation, but was less inhibitory to cell proliferation. In contrast, some other analogs such as 2,4- or 3,5-dihydroxyphenylacetate were found to be highly toxic (Please see section III, herein for further discussion).

EXAMPLE 8

The effectiveness of NaPA as an antitumor agent was further evaluated in a variety of experimental models. Studies of depth were performed with two androgen- independent human prostate adenocarcinoma cell lines, PC3 and DU145, established from bone and brain metastases, respectively. NaPA treatment of the prostatic cells resulted in concentration-dependent growth arrest, accompanied by cellular swelling and accumulation of lipid. The results of this study are shown in FIG. 4. As illustrated therein, an IC50 for NaPA occurred at 600-800 ug/ml. Significantly higher doses were needed to affect the growth of actively replicating normal human FS4 skin fibroblasts, indicating a selective cytostatic effect of the drug.

EXAMPLE 9

It is known that PC3 cells are invasive in vitro and metastatic in recipient athymic mice. [Albini, A. et al. A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res. 47:3239-3245 (1987)]. The invasiveness of PC3 cells which is indicative of their malignant phenotype can be assessed by their ability to degrade and cross tissue barriers such as matrigel, a reconstituted basement membrane. Untreated PC3 cells and PC3 cells treated with NaPA for 4 days in culture were quantitatively analyzed in a modified Boyden chamber containing a matrigel-coated filter with FS4 conditioned medium as a chemoattractant. After 4 days of treatment with 800 ug/ml of NaPA in T.C. plastic dishes, 5.times.10.sup.4 cells were replated onto 16 mm Costar dishes coated with 250.ltoreq.1 of matrigel. Pictures of controls taken after 1 and 8 days, show the characteristic growth pattern of untreated cells, i.e., formation of net-like structures composed of actively replicating cells which eventually degraded the matrigel and formed monolayers on the plastic surface beneath. In contrast to the controls, the NaPA treated cells formed isolated small colonies which resembled normal human FS4 cells as shown in C and D taken 8 days after plating. The NaPA treated cells failed to degrade the matrigel barrier. The formation of small noninvasive colonies on top of the matrigel is indicative of loss of malignant properties following treatment. Results of the in vitro invasion assays correlate highly with the biological behavior of cells in vivo.

EXAMPLE 10

Indeed, PC3 cells treated with NaPA for one week in culture, in contrast to untreated cells or those treated with PAG, failed to form tumors when transplanted s.c. into athymic mice. These results are shown in Table 5.

TABLE 5 ______________________________________ Tumorigenicity of Prostatic PC3 Cells in Nude Mice. TUMORS TREATMENT Incidence Diameter Weight (mg/ml) (mm .+-. S.D.) (mg) ______________________________________ None 7/7 9 .+-. 3 285 .+-. 60 NaPA 0.8 1/7 2 50 PAG 0.8 3/4 8 .+-. 2 245 .+-. 35 ______________________________________

PC3 cells were pretreated for 1 week in culture and then injected (2.times.10.sup.5 cells/animal) s.c. into 4-5 week-old female athymic nude mice. The results in Table 5 indicate the incidence of tumor bearing animals/injected animals as well as tumor size measured as mean diameter .+-.S.D. 8 weeks later. The data in Table 4 are a summary of two independent experiments.

EXAMPLE 11

To further substantiate the phenotypic changes observed in the NaPA treated prostatic PC3 cells, Northern blot analysis revealed that NaPA inhibited the expression of collagenase type IV, one of the major metalloproteases implicated in degradation of basement membrane components, tumor cell invasion, and metastasis. Furthermore, it was found that NaPA treated prostatic PC3 cells showed an increase in the level of HLA-A mRNA which codes for major histocompatibility class I antigen known to affect tumor immunogenicity in vivo.

NaPA in Combination with Suramin

TABLE 6 ______________________________________ Malignant Melanoma A375 Treatment Growth Viability (ug/ml) (% of control) (%) ______________________________________ None 100 >95 NaPA 400 63.3 >95 Suramin 38 78.3 >95 75 56.8 >95 150 38.6 92 300 26.6 82 NaPA (400) + Suramin (38) 45.5 >95 + Suramin (75) 30.1 94 + Suramin (150) 21.8 92 ______________________________________

TABLE 7 ______________________________________ Prostate Adenocarcinoma PC3 Treatment Growth Viability (ug/ml) (% of control) (%) ______________________________________ None 100 >95 NaPA 800 59.6 >95 Suramin 75 58.5 nd 150 46.5 nd 300 31.0 nd NaPA (800) + Suramin (75) 24.2 90 + Suramin (150) 10.9 64 ______________________________________

NaPA was found to significantly potentiate the therapeutic effect of suramine, the only experimental drug known to be active against prostrate cancer.

It is known that a disease state characterized by the presence of benign hyperplastic lesions of the prostate exists as a separate disease entity and has been identified in many patients that progress to a diagnosis of prostatic cancer. Based on the above, it is anticipated that NaPA, in addition to being effective in the treatment of prostatic cancer, would be effective in treating patients having benign hyperplastic prostatic lesions.

Further experiments demonstrated that NaPA appears to have broad antitumor activity affecting a wide spectrum of malignancies. The experimental data indicate presented in Table 5 that NaPA 0.4-0.8 mg/ml caused about 50% inhibition of growth in treated adenocarcinoma of the prostate cell lines PC3 and DU145, melanoma A375 and SK MEL 28, lung adenocarcinoma H596 and H661, and astrocytoma U87, U373, and 343. Somewhat higher concentrations (1.0-1.5 mg/ml) were needed to cause a similar inhibition of squamous cell carcinoma A431, breast tumor MCS-7, osteosarcoma KRIB, and fibrosarcoma V7T. Typically, NaPA treatment was associated with growth arrest, induction of differentiation markers, reduced invasiveness in vitro, and loss of tumorigenicity in nude mice.

TABLE 8 ______________________________________ RESPONSES OF DIFFERENT TUMOR CELL LINE TO NaPA TREATMENT % Inhibition by # Tumor Cell Line NaPA 0.8 mg/ml a ______________________________________ 1 Melanoma A375 .gtoreq.70 SK MEL 28 >50 2 Prostatic Ca b PC3 .gtoreq.50 Du145 .gtoreq.50 LaNCoP >50 3 Astrocytoma U87 .gtoreq.50 U343 .gtoreq.50 U373 .gtoreq.50 4 Kaposi’s Sarcoma KS .ltoreq.40 5 Leukemia HL-60 .ltoreq.40 6 Leukemia K562 .ltoreq.30 7 Breast Ca. MCF-7 .ltoreq.30 8 Osteosarcoma KRIB .ltoreq.30 HOS <20 9 Fibrosarcoma V7T .ltoreq.30 RS485 .ltoreq.30 10 Squamous Ca. of Head & Neck A431 <30 ______________________________________ a Pharmacologically attainable concentration b Carcinoma

Of major interest in Table 4 are the following:

#1-3 Tumor cells show significant response i.e., .gtoreq.50 inhibition of proliferation within one week of treatment.

#4 KS, an HIV-associated disorder, may be more dramatically affected by NaPA in humans, due to inhibition of HIV expression and of essential growth factors released by infected lymphocytes.

#5,6 The treated HL-60 promeyelocytic leukemic cells undergo terminal differentiation, a desirable outcome of chemotherapy. In the K562 erythroleukemia, NaPA induced reversible erythroid diferentation with no significant growth arrest (<30); thus the K562 data is of interest with respect to treatment of certain anemias, not cancer.

Less attractive:

#7-10 For effective responses, the tumors may require much higher drug concentrations if used alone.

Although some of the malignant cell lines seem more sensitive than others, all were significantly more affected by NaPA when compared to normal or benign cells. For example, NaPA inhibited the growth of malignant osteosarcoma (KRIB) cells more so than benign osteosarcoma-derived HOS cells. A differential effect was seen also in ras-transformed fibrosarcoma V7T, when compared to the parental non-tumorigenic N1H3T3 cells. As to normal human cells, as much as 2-4 mg/ml of NaPA were needed to cause a significant inhibition of growth to primary human skin FS4 fibroblasts. It should be noted that the treatment was not toxic to either the malignant or the normal cells.

The concentration range found to selectively suppress malignant growth can be readily obtained in the clinical setting without causing significant side effects. Intravenous infusion of humans with NaPA at 250-500 mg/kg/day which results in plasma levels of 600-800 ug/ml has been found to be a well tolerated treatment. Cytotoxicity in tissue culture was observed when the NaPA concentration was >3 mg/ml.

SECTION B

PHENYLACETATE AND ITS DERIVATIVES IN THE TREATMENT AND PREVENTION OF AIDS

The etiology of human acquired immunodeficiency syndrome (AIDS) has been linked to the human immunodeficiency virus (HIV), which is capable of selective infection and suppression of the host immune system. The immune defect renders the human body susceptible to opportunistic infections and cancer development, which are ultimately fatal. The spread of HIV throughout the world is rapid, with no effective therapeutics on hand. It is suggested that NaPA, a nontoxic natural compound capable of glutamine depletion in vivo, could potentially be used in the treatment and prevention of AIDS.

HIV is a retrovirus. The production of retroviruses is dependent on transcriptional activation by the long terminal repeat (LTR) element, and the availability of glutamine (Gln) for translational control. Experimental data obtained with chronically infected cultured cells and animal models indicate that virus replication is inhibited specifically in cells starved for glutamine, but not for other amino acids (Gloger and Panet (1986); (J. Gen. Virol. 67:2207-2213) Roberts and McGregor, (1991), (J. Gen. Virol 72:2199-305). The results could not be attributed to either an effect on cell cycle or a general inhibition of protein synthesis.

The reason why glutamine depletion leads to virus suppression cab be explained as follows. Replication competent murine retroviruses contain an amber termination codon at the junction of gag and pol genes, which can be recognized by amber suppressor tRNA.sup.Gln. Glutamine is thus essential for the readthrough of viral mRNA transcripts (Yoshinaka et al (1985)); PNAS 82:1618-1622 reduction in glutamine concentrations disrupts viral mRNA translational readthrough and protein synthesis, with subsequent inhibition of viral assembly and secondary spread. Although human retroviruses are somewhat different from the murine viruses studied, it has been shown that reduction in the levels of amber suppressor tRNA.sup.Gln in human cells infected with HIV causes a significant reduction in the synthesis of viral proteins [(Muller et al Air Research and Human Retroviruses 4:279-286 1988)]. Such data suggest that agents which can lower glutamine levels in humans, are likely to benefit patients infected with HIV. NaPA may be such as agent, since it is known to conjugate to glutamine in humans with subsequent renal excretion of phenylacetylglutamine. Since NaPA possesses also antitumor activities, the drug is likely to affect Kaposi’s sarcomas, the tumors found in as many as 30% of all AIDS patients, as well as lymphoma associated with AIDS.

EXAMPLE 13

Evidence from experimental model systems in support the above hypotheses include: (a) Our preliminary findings with cultured cells indicate that NaPA can inhibit expression of genes controlled by the retroviral LTR; (b) While animal studies have been hindered by the fact that glutamine depletion by NaPA is limited to humans and high primates, an acceptable animal model (other than primates) involves rodents treated with glutaminase. Glutaminase is a bacterial enzyme that causes reduction of extracellular (and presumably intracellular) glutamine concentrations. Glutaminase treatment of viremic mice infected with Rouscher murine leukemia virus (RLV) inhibited retroviral replication and the development of splenomegaly, and significantly increased animal survival [Roberts and McGregor J. Gen. Virology 72:299-305 (1991)]. The efficacy of glutaminase therapy compared favorably with AZT, the drug currently used for treatment of AIDS. The results are of particular interest since the RLV serves as a model in the search for anti-HIV drugs (Ruprecht et al, 1986). Unfortunately, however, glutamine depletion by glutaminase in vivo is only transient due to development of neutralizing antibodies to the enzyme; once this occurs, viral replication can resume, eventually killing the host. NaPA, unlike the bacterial glutaminase, is a natural component of the human body, and thus is less likely to induce the production of neutralizing antibodies; (c) There is clinical evidence for sustained reduction by NaPA of plasma glutamine concentrations. NaPA is currently being used for treatment of hyperammonemia associated with inborn disorders of urea metabolism. The clinical experience indicate that long-term treatment with NaPA effectively reduces glutamine levels. Such treatment is nontoxic and well tolerated even by newborns. In conclusion, we propose that NaPA might benefit patients with HIV infection. NaPA could inhibit viral replication through (among other mechanisms) inhibition of LTR and depletion of glutamine, the aminoacid required for appropriate processing of viral proteins. If NaPA proves to have anti-HIV activities in humans, it could be used to prevent disease progression in asymptomatic HIV-positive individuals. The lack of toxicity, easy oral administration and relatively low cost, uniquely qualify NaPA as a chemopreventive drug. In fact, the drug is so well tolerated by humans that treatment can start just a few hours after birth. In addition, NaPA could be used (alone or in combination with other drugs) in treatment of AIDS-associated disorders including opportunistic infections, HIV encephalopathy, and neoplasia.

SECTION C

INDUCTION OF FETAL HEMOGLOBIN SYNTHESIS IN .beta.-CHAIN HEMOGLOBINOPATHY BY PHENYLACETATE AND ITS DERIVATIVES

There is considerable interest in identifying nontoxic therapeutic agents for treatment of severe .beta.-chain hemoglobinopathies. Employing the human leukemic K562 cell line as a model, we have explored the cellular responses to NaPA, an amino acid derivative essentially nontoxic to humans. Treatment of cultures with pharmacologically attainable concentrations of NaPA resulted in time- and dose dependent inhibition of cell proliferation and caused an increase in hemoglobin production. Molecular analysis revealed accumulation of the fetal form of hemoglobin (HbF), which was associated with elevated steady-state levels of gamma globin mRNA. All NaPA effects reversed upon cessation of treatment. Interestingly, addition of NaPA to other antitumor agents of clinical interest, i.e., 5-azacytidine and hydroxyurea, resulted in superinduction of HbF biosynthesis. The results suggest that NaPA, an agent known to be well tolerated by newborns, could be used alone or in combination with other drugs for long-term treatment of some inborn blood disorders. The pathophysiology of inherited blood disorders such as sickle cell anemia and severe .beta.-thalassemias is based on genetic abnormalities in the .beta.-globin gene which result in deficient or absent .beta.-globin synthesis. The latter prevents the production of hemoglobin and results in ineffective red blood cell production and circulation. Recent data indicate that pharmacological manipulation of the kinetics of cell growth and differentiation might have beneficial effect in patients with the .beta.-chain hemoglobinopathies, due to the induction of fetal hemoglobin (HbF) synthesis. To date, several antitumor drugs including 5-azacytidine (5AzaC), 5-aza-2′-deoxycytidine (5AzadC), hydroxyurea (HU), vinblastine, and arabinosylcytosine (ara-C) have been shown to increase the production of HbF in experimental models [Dover, Ann NY Acad Sci 612:184-190 (1990)]. Moreover, there is clinical evidence for 5AzaC and HU activity in sever .beta.-thalassemia and sickle cell anemia, respectively. However, concerns regarding toxic and potential carcinogenic effects of the prevailing antitumor drugs raise the need to identify safe alternatives for long-term treatment of the inborn nonmalignant diseases. The accumulation of fetal hemoglobin in adults is thought to be due to changes in the kinetics of erythroid differentiation rather than a direct effect on the fetal globin genes. According to this hypothesis, other agents that can induce differentiation would also be expected to affect HbF production. The focus here is on the efficacy of a novel nontoxic differentiating agent, sodium phenylacetate (NaPA).

As discussed in Section A Applicant’s laboratory has found that NaPA can also affect the maturation (i.e., differentiated state) of various animal and human cell types. The drug caused growth arrest and reversal of malignant properties in a variety of in vitro tumor models including cell lines established from adenocarcinomas of the prostate and lung, malignant melanomas, and astrocytomas. Moreover, NaPA treatment was associated with adipocyte conversion in premalignant mesenchymal C3H 10T1/2 cells, and granulocyte differentiation in promyelocytic leukemia HL-60 cultures. Studies indicated that NaPA, in contrast to the chemotherapeutic differentiating drugs 5AzaC and 5AzadC, may be free of adverse effects such as cytotoxicity and tumor progression.

Indeed, NaPA is well tolerated by humans as indicated by the vast clinical experience with NaPA is in the treatment of hyperammonemia in infants with inborn errors of ureagenesis. The clinical experience indicates that acute or long-term treatment with high doses of NaPA is essentially free of adverse effects. The lack of toxicity and the ability to induce cellular differentiation prompted Applicant to examine the effect of NaPA on HbF expression.

EXAMPLE 14

The experimental system involved the human leukemic K562 cells, which carry a nonfunctional .beta.-globin gene, but produce low levels of the fetal gamma globin and of HbF. The K562 cell line was originally established from a patient with chronic myelogenous leukemia in the blast cells transformation, and has since been extensively utilized as a model in studies of erythroid differentiation and regulation of the gamma globin gene expression. We show here for the first time that pharmacologically attainable concentrations of NaPA can promote HbF biosynthesis in the human leukemic cells, and can cause superinduction when combined with the other chemotherapeutic agents of interest, 5AzaC and HU.

MATERIALS AND METHODS

Cell Culture and reagents. The human leukemia K562 cells were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum (Gibco), 50 U/ml penicillin, 50 ug/ml streptomycin, and 2 mM L-glutamine unless otherwise indicated. The suspension cultures were kept in exponential growth phase by diluting every 3-5 days with fresh medium, and cell viability was determined by trypan blue exclusion. Phenylacetic acid, 4-hydroxyphenyl acetic acid, 3,4-dihydroxyphenyl acetic acid, 2,5-dihyroxyphenyl acetic acid (Sigma, St. Louis Mo.) and PAG (a gift from L. Trombetta, Houston Tex.) were dissolved in distilled water, and brought to pH 7.0 by the addition of NaOH, DON, acivicin, 5AzadC, 5AzaC, and HU (Sigma) were also dissolved in distilled. All drug stock solutions were stored in aliquots at -20.degree. C. until used.

Determination of Hemoglobin Production. K562 cells were seeded at 1.times.10.sup.5 cells/ml and treated with the drugs for four to seven days prior to assay. Qualitative estimation of hemoglobin production was determined by benzidine staining of intact cells in suspension. The hemoglobin concentration within cells was determined by the protein absorption at 414 nm (). Briefly, 1.times.10.sup.7 cells were lysed in 1 ml of lysing buffer (0.12% Tris pH 7.4, 0.8% NaCl, 0.03% Mg-acetate, and 0.5% Np-40), vortexed and incubated on ice gor 15 minutes. The lysate were then centrifuged for 15 minutes at 1500 rpm at 4.degree. C., and the absorption of the supernatant monitored between 350 nm and 650 nm using Beckman Du-7 scanning spectrophotometer. The hemoglobin was quantitated using the relationship of 1.0 optical density (OD) at 414 nm corresponding to 0.13 mg/ml hemoglobin as described before.

Northern Blot Analysis and DNA probes. Cytoplasmic RNA was prepared from cultures at logarithmic phase of growth and separated on 1% agarose-formaldehyde gels. Gel electrophoresis, transfer of RNA onto nytran membranes (Schleicher & Schuell), hybridization with radiolabeled DNA probes, and autoradiography (Kodak X-ray film XAR5) were according to established procedures. The probe for gamma globin was a 0.6 Kb Eco RI/Hind III fragment of the human gamma globin gene. Probes were labeled with [.sup.32 P]dCTP (NEN) using random primed DNA labeling kit (Boehringer Mannheim, West Germany).

Analysis of HbF Protein Synthesis. Newly synthesized proteins were labeled with .sup.35 S-methionine and the HbF immunoprecipitated and analyzed as previously described. Briefly, cells (1.times.10.sup.6 per point in 1 ml) were first subjected to 1 hr starvation in methionine-free medium, then incubated in the presence of 100 uCi/ml of .sup.35 S-methionine for 2 hrs. The labeled cells were harvested, washed and lysed in a lysing buffer containing 10 mM phosphate buffer pH 7.4, 1% Triton X100, 0.1% SDS, 0.5% deoxychilate, 100 mM NaCl, 0>1% NaN3, 2 mM PMSF, and 10 ug/ml lenpeptin. 1.times.10.sup.7 cpm of TCA precipitable count of cytoextract was incubated with rabbit anti-human HbF (Pharmacia) and protein A Sepharose at 4.degree. C., and the immunoprecipitates were separated by electrophoresis on 12% SDS-polyacrylamide gels.

RESULTS

The Effect of NaPA and Analogues on Cell Growth and Differentiation. Treatment of the K562 cultures with NaPA resulted in dose dependent inhibition of cell proliferation, with 1.4 mg/ml causing 50% reduction in cell number after four days of treatment. No toxicity was observed with doses as high as 2.0 mg/ml. In addition to the cytostatic effect, NaPA also induced erythroid differentiation, as indicated by an increase in the number of benzidine-positive cells (FIG. 5) and confirmed by quantitative analysis of hemoglobin production (Table 9). Similar treatment with PAG, which is the glutamine conjugated form of NaPA, had no significant effect on either cell proliferation or hemoglobin accumulation suggesting that the changes associated with NaPA treatment are specific and not due to alterations in culture conditions.

The effect of NaPA on cell growth and differentiation could be mimicked by the use of 4-hydroxyphenylacetate (Table 10). This was in marked contrast to the analogues 3,4-dihydroxyphenylacetate and 2,5-dihyroxyphenylacetate, which were highly toxic to the cells (LD50 of 60 and 100 ug/ml, respectively), and did not induce differentiation.

Regulation of Fetal Hemoglobin Production by NaPA. K562 cells normally express low but detectable levels of HbF. Protein analysis employing anti-HbF antibodies revealed significantly increased amounts of HbF in cells treated with NaPA compared to untreated controls; this was associated with elevated steady-state levels of the fetal gamma globin mRNA. The effect of NaPA on HbF production was time and dose dependent, and apparently reversible upon cessation of treatment.

Glutamine Starvation and HbF Production. NaPA treatment of humans can lead to depletion of circulating glutamine due to conjugation to glutamine and formation of PAG, an enzymatic reaction known to take place in the liver and kidney. The in vivo reduction in plasma glutamine was mimicked in vitro by culturing the K562 cells in the presence of lowered glutamine concentrations. Results presented in Table 9 show, in agreement with previous reports, that glutamine starvation alone can affect the growth rate as well as HbF production in the K562 cells. Addition of NaPA to the glutamine-depleted growth medium further augmented the cytostatic and differentiating effects observed. We speculate therefore that the effect of NaPA on erythroid differentiation and HbF production in humans may be even more dramatic than that observed with the in vitro model, due to depletion of circulating glutamine and a direct effect on the erythroid progenitor cells.

Potentiation by NaPA of Erythroid Differentiation induced by Other Chemotherapeutic Drugs. There is considerable interest in the use of 5AzaC, 5AzadC and HU for treatment of sickle cell anemia and .beta.-thalassemia; however, the clinical use of these drugs is often limited by unacceptable toxicities. Combination treatments with nontoxic differentiating agents like NaPA could enhance hemoglobin production while minimizing the adverse effects. We tested therefore the efficacy of various combinations of NaPA with the other drugs of clinical interest. Results, summarized in Table 10, show that addition of NaPA 800 ug/ml, to low doses of 5AzadC or HU act synergitically to further augment HbF production with no toxic effect to cells. The concentration of HU used in these experiments is comparable to the plasma HU levels measured in sickle cell anemia patients following an oral administration of 25 mg/kg [(Goldberg et al. New England J Med 323:366-372 (1990)]. As to NaPA, pharmacokinetics studies in children with urea cycle disorders indicate that plasma levels of approximately 800 ug/ml can be obtained by infusion with 300-500 mg/kg/day, a treatment well tolerated even by newborns.

DISCUSSION

Chemotherapeutic agents selected for their low cytotoxic/mutagenic potential could be used for induction of fetal hemoglobin in patients with congenital sever anemias such as sickle cell and .beta.-thalassemia. Drug toxicity is an important consideration in view of overall health condition and the variable life-span of patients with these nonmalignant blood disorders. Unfortunately, recombinant human erythropoietin, which has proved to be both nontoxic and effective therapy for anemia associated with chronic renal disease, is apparently ineffective in the treatment of sickle cell anemia. The application of other active drugs such as 5AzadC, HU, vinblastine and ara-C has been hindered by concerns regarding their carcinogenic effects. HU is also difficult to use because of the narrow margin between toxicity and the desired effect on increased HbF production [(Dover, et al., Blood 67:735-738 (1986)]. By contrast, NaPA, shown here to affect HbF production, is so well tolerated by humans that treatment can be initiated just a few hours after birth.

Using an in vitro model involving human leukemic K562 cells, we have demonstrated that NaPA can promote the maturation of early erythroid progenitor cells that have an active HbF program. Addition of NaPA to other therapeutic agents currently in clinical use, i.e., 5AzaC, 5AzadC, or HU resulted in superinduction of HbF synthesis. 5AzaC has been shown to be less toxic and more effective than HU in stimulating HbF production. Moreover, 5AzaC, unlike HU, is effective in treatment of both sickle cell anemia and .beta.-thalassemia. Such data are consistent with the interpretation that 5AzaC acts by both perturbation of erythropoiesis and by its effect on DNA methylation. However, while hypomethylation can lead to gene activation and cell differentiation, it can also promote oncogenesis and the evolution of cells with metastatic capabilities. Our results obtained with the K562 erythroid progenitor cells indicate that the therapeutic effects of NaPA compare favorably with those of 5AzadC, yet NaPA (unlike the cytosine analog) did not cause tumor progression. Moreover, NaPA was shown to prevent tumor progression induced by 5AzadC.

The data presented here suggest that NaPA, used alone or in combination with other drugs, might be of value in treatment of leukemias and .beta.-chain hemoglobinopathies. In addition to promoting the production of red blood cells expressing HbF through nontoxic mechanisms, NaPA may also minimize the adverse effects of other antitumor drugs currently in clinical use.

TABLE 9 ______________________________________ HbF Accumulation in Treated K562 Cells Treatment (mg/ml) Benzidine Positive Cells HbF production increase (%) fold increase (pg/cell) fold ______________________________________ None 2.2 .+-. 0.8 1 0.35 .+-. 0.06 1 NaPA 0.4 2.7 .+-. 0.2 1.2 0.49 .+-. 0.02 1.4 0.8 7.0 .+-. 0.3 3.2 1.15 .+-. 0.20 3.3 1.6 14.6 .+-. 0.2 6.6 2.40 .+-. 0.16 6.8 4HP 1.6 14.2 .+-. 0.5 6.45 ND PAG 2.6 2.1 .+-. 0.5 0.95 0.37 .+-. 0.03 1.06 ______________________________________

TABLE 10 ______________________________________ Glutamine Starvation and HbF Production HbF (pg/cell) Gln starvation Gln (mM) alone plus NaPA (0.8 mg/ml) ______________________________________ 2.0 0.39 .+-. 0.04 1.0 .+-. 0.06 0.5 0.56 .+-. 0.01 1.15 .+-. 0.01 0.2.sup.a 1.17 .+-. 0.12 1.75 .+-. 0.22 0.1.sup.a 1.86 .+-. 0.40 2.22 .+-. 0.20 ______________________________________ .sup.a The concentration of NaPA used in this study (0.8 mg/ml) is pharmacologically attainable without toxicity. In children such a treatment is expected to cause a drop in circulating glutamine plasma levels to 0.1-0.2 mM. The results presented above indicate that under suc conditions HbF production increases 4.5-5.7 fold compared to controls. We propose therefore that the effect of NaPA in children might be more dramatic then that seen under routine culture conditions # (i.e., cell growth in medium with 2 mM Gln).

TABLE 11 ______________________________________ Potentiation by NaPA of HU’s Therapeutic Effect Treatment HbF (pg/cell) ______________________________________ none 0.39 .+-. 0.04 NaPA (0.8 mg/ml) 1.64 .+-. 0.07 HU (50 uM) 1.00 .+-. 0.03 HU (50 uM) + NaPA 5.91 .+-. 0.6.sup.b HU (100 uM) 2.12 .+-. 0.04 HU (100 uM) + NaPA 6.71 .+-. 0.05.sup.b ______________________________________ .sup.a To mimic the effect of NaPA in vivo, treatments involving NaPA wer performed in medium supplemented with 0.2 mM Gln (see explanation to tabl 2). Control untreated cells and those treated with HU or 5AzadC alone wer maintained in growth medium with 2 mM gln. .sup.b The results indicate that NaPA and HU act synergistically to induc HbF Production in the erytroid progenitor cells Note: Similar results have been obtained for the combination NaPA 0.8 mg/ml and 5AzadC 0.3 uM.

Contemplated Models of Drug Administration

NaPA may be administered locally or systemically. Systemic administration means any or route of administration which results in effective levels of active ingredient appearing in the blood or at a site remote from the site of administration of said active ingredient.

The pharmaceutical formulation for systemic administration according to the invention may be formulated for intravenous, intramuscular, sub-cutaneous, oral, nasal, enteral, parenteral or topical administration. In some cases, combination of types of formulations may be used simultaneously to achieve systemic administration of the active ingredient.

Suitable formulations for oral administration include hard or soft gelatin capsules, dragees, pills, tablets, including coated tablets, elixirs, suspensions, and syrups or inhalations.

Solid dosage forms in addition to those formulated for oral administration include rectal suppositories.

The compounds of the present invention may also be administered in the form of an implant.

Suitable formulations for topical administration include creams, gels, jellies, mucilages, pastes and ointments.

Suitable injectable solutions include intravenous, subcutaneous, and intramuscular injectable solutions. The compounds of the present invention may also be administered in the form of an infusion solution or as a nasal inhalation or spray.

The compounds of the present invention may also be used concomitantly or in combination with selected biological response modifiers, e.g., interferons, interleukins, tumor necrosis factor, glutamine antagonists, hormones, vitamins, as well as anti-tumor agents and hematopoetic growth factors, discussed above.

It has been observed that NaPA is somewhat malodorous. Therefore, it may be preferable to administer this compound in the presence of any of the pharmaceutically acceptable odor-masking excipients or as its precursor phenylbutyrate which has no offensive odor.

The PAA and its pharmaceutically acceptable derivatives to be used as antitumor agents can be prepared easily using pharmaceutical materials which themselves are available in the art and can be prepared by established procedures. The following preparations are illustrative of the preparation of the dosage forms of the present invention, and are not to be construed as a limitation thereof.

EXAMPLE 14

PARENTERAL SOLUTION

A sterile aqueous solution for parenteral administration containing 200 mg/ml of NaPA for treating a neoplastic disease is prepared by dissolving 200 g. of sterilized, micronized NaPA in sterilized Normal Saline Solution, qs to 1000 ml. The resulting sterile solution is placed into sterile vials and sealed. The above solution can be used to treat malignant conditions at a dosage range of from about 100 mg/kg/day to about 1000 mg/kg/day. Infusion can be continuous over a 24 hour period.

EXAMPLE 15

PARENTERAL SOLUTION

A sterile aqueous solution for parenteral administration containing 50 mg/ml of NaPA is prepared as follows:

______________________________________ Ingredients Amount ______________________________________ NaPA, micronized 50 g. Benzyl alcohol 0.90% w/v Sodium chloride 0.260% w/v Water for injection, qs 1000 ml ______________________________________

The above ingredients, except NaPA, are dissolved in water and sterilized. Sterilized NaPA is then added to the sterile solution and the resulting solution is placed into sterile vials and sealed. The above solution can be used to treat a malignant condition by administering the above solution intravenously at a flow rate to fall within the dosage range set forth in Example 14.

EXAMPLE 16

PARENTERAL SOLUTION

A sterile aqueous solution for parenteral administration containing 500 mg/ml of sodium phenylbutyrate is prepared as follows:

______________________________________ Ingredients Amount ______________________________________ Sodium phenylbutyrate 500 g. Dextrose 0.45% w/v Phenylmercuric nitrate 0.002% w/v Water for injection, qs 1000 ml. ______________________________________

The preparation of the above solution is similar to that described in Examples 14 and 15.

EXAMPLE 17

TABLET FORMULATION

A tablet for oral administration containing 300 mg of NaPA is prepared as follows:

______________________________________ Ingredients Amount ______________________________________ NaPA 3000 g. Polyvinylpyrrolidone 225 g. Lactose 617.5 g. Stearic acid 90 g. Talc 135 g. Corn starch 432.5 g. Alcohol 45 L ______________________________________

NaPA, polyvinylpyrrolidone and lactose are blended together and passed through a 40-mesh screen. The alcohol is added slowly and the granulation is kneaded well. The wet mass is screened through a 4-mesh screen, dried overnight at 50.degree. C. and screened through a 20-mesh screen. The stearic acid, talc and corn starch is bolted through 60-mesh screen prior to mixing by tumbling with the granulation. The resulting granulation is compressed into tablets using a standard 7/16 inch concave punch.

EXAMPLE 18

TABLET FORMULATION

A tablet for oral administration containing 200 mg of sodium phenylbutyrate is prepared as follows:

______________________________________ Ingredients Amount ______________________________________ Sodium phenylbutyrate 2240 g. Compressible sugar (Di-Pac) 934 g. Sterotex 78 g. Silica gel (Syloid) 28 g. ______________________________________

The above ingredients are blended in a twin-shell blender for 15 minutes and compressed on a 13/22 inch concave punch.

EXAMPLE 19

INTRANASAL SUSPENSION

A 500 ml sterile aqueous suspension is prepared for intranasal installation as follows:

______________________________________ Ingredients Amount ______________________________________ NaPA, micronized 30.0 g. Polysorbate 80 2.5 g. Methylparaben 1.25 g. Propylparaben 0.09 g. Deionized water, qs 500 ml ______________________________________

The above ingredients, with the exception of NaPA, are dissolved in water and sterilized by filtration. Sterilized NaPA is added to the sterile solution and the final suspensions are aseptically filled into sterile containers.

EXAMPLE 20

OINTMENT

An ointment is prepared from the following ingredients:

______________________________________ Ingredients Amount ______________________________________ NaPA 10 g. Stearyl alcohol 4 g. White wax 8 g. White petrolatum 78 g. ______________________________________

The stearyl alcohol, white wax and white petrolatum are melted over a steam bath and allowed to cool. The NaPA is added slowly to the ointment base with stirring.

EXAMPLE 21

LOTION

______________________________________ Ingredient Amount ______________________________________ Sodium phenylbutyrate 1.00 g. Stearyl methylcellulose (4,500) 25.00 ml. solution (2%) Benzalkonium chloride 0.03 g. Sterile water 250.00 ml ______________________________________

The benzalkonium chloride is dissolved in about 10 ml. of sterile water. The sodium phenylbutyrate is dispersed into methylcellulose solution by means of vigorous stirring. The methylcellulose (4,500) used is a high viscosity grade. The solution of benzalkonium chloride is then added slowly while stirring is continued. The lotion is then brought up to the desired volume with the remaining water. Preparation of the lotion is carried out under aseptic conditions.

EXAMPLE 22

DUSTING POWDER

______________________________________ Ingredients Amount ______________________________________ NaPA 25 g. Sterilized absorbable maize 25 g. starch BP dusting powder ______________________________________

The dusting powder is formulated by gradually adding the sterilized absorbable dusting powder to NaPA to form a uniform blend. The powder is then sterilized in conventional manner.

EXAMPLE 23

SUPPOSITORY, RECTAL AND VAGINAL PHARMACEUTICAL PREPARATIONS

Suppositories, each weighing 2.5 g. and containing 100 mg. of NaPA are prepared as follows:

______________________________________ Ingredients Amount/1000 ______________________________________ suppositories NaPA, micronized 100 g. Propylene glycol 150 g. Polyethylene glycol 4000, qs 2500 g. ______________________________________

NaPA is finely divided by means of an air micronizer and added to the propylene glycol and the mixture is passed through a colloid mill until uniformly dispersed. The polyethylene glycol is melted and the propylene glycol dispersion added slowly with stirring. The suspension is poured into unchilled molds at 40.degree. C. Composition is allowed to cool and solidify and then removed from the mold and each suppository is foil wrapped.

The foregoing suppositories are inserted rectally or vaginally for treating neoplastic disease.

It is known that intracellular glutathione plays a major role in detoxification and repair of cellular injury by chemical and physical carcinogens. NaPA treatment of normal or tumor cells markedly induced the activity of intracellular glutathione approximately 2-10 fold depending on growth conditions. Nontoxic agents that can induce glutathione are highly desirable since these are likely to protect cells from damage by a variety of chemical carcinogens and ionizing radiation.

Taken together, the present invention demonstrates that NaPA has valuable potential in cancer prevention in cases such as high risk individuals, for example, heavy smokers with familial history of lung cancer, inherited disorders of oncogene abnormalities (Li-Fraumeni syndrome), individuals exposed to radiation, and patients in remission with residual disease. Furthermore, NaPA can be used in combination with other therapeutic agents, such as chemicals and radiation, to enhance tumor responses and minimize adverse effects such as cytotoxicity and carcinogenesis. The antitumor activity, lack of toxicity, and easy administration qualify NaPA as a preferred chemopreventive drug.

Comments (0)

Detection of mammary tumor virus-like sequences in human breast cancer

Filed under: Issued Patent — admin @ 3:21 am

Abstract
The present invention relates to materials and methods for diagnosing breast cancer in humans. It is based, at least in part, on the discovery that a substantial percentage of human breast cancer tissue samples contained nucleic acid sequences corresponding to a portion of the mouse mammary tumor virus env gene. In contrast, such sequences were absent in almost all other human tissues tested.

——————————————————————————–
Inventors: Pogo; Beatriz (Pelham, NY), Holland; James (Scarsdale, NY)
Assignee: Mount Sinai School of Medicine (New York, NY)

Appl. No.: 08/745,892
Filed: November 8, 1996
Government Interests

——————————————————————————–

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

This invention was made with funds from the U.S. government, which has certain rights in the invention.
——————————————————————————–

Parent Case Text

——————————————————————————–

CROSS-REFERENCE TO RELATED APPLICATION

This application is a continuation-in-part application of U.S. Serial No. 08/555,394, filed Nov. 9, 1995, now U.S. Pat. NO. 5,686,247.
——————————————————————————–

Claims

——————————————————————————–

We claim:

1. An antibody which specifically binds to a peptide encoded by a nucleic acid having the sequence set forth in SEQ ID NO: 17.

2. An antibody which specifically binds to a peptide encoded by a nucleic acid having the sequence set forth in SEQ ID NO: 18.

3. An antibody which specifically binds to a peptide encoded by a nucleic acid which hybridizes, under stringent conditions, to a nucleic acid having a sequence as set forth in SEQ ID NO: 17, as occurs between residues 976 and 1640 of the mouse mammary tumor virus env gene, and which does not hybridize to any other region of the mouse mammary tumor virus genome.

4. An antibody which specifically binds to a peptide having an amino acid sequence selected from the group consisting of LKRPGFQEHEMI (SEQ ID NO: 13), GLPHLIDIEKRG (SEQ ID NO: 14), TNCLDSSAYDTA (SEQ ID NO: 15) and DIGDEPWFDD (SEQ ID NO: 16).

5. A method of diagnosing breast cancer in a subject, comprising detecting the presence, in the subject, of a peptide encoded by a nucleic acid having the sequence set forth in SEQ ID NO: 17 by binding the peptide to an antibody according to claim 1.

6. The method of claim 5 wherein the presence of the peptide is detected in a sample collected from the subject.

7. A method of diagnosing breast cancer in a subject, comprising detecting the presence, in the subject, of a peptide encoded by a nucleic acid having the sequence set forth in SEQ ID NO: 18 by binding the peptide to an antibody according to claim 2.

8. The method of claim 7 wherein the presence of the peptide is detected in a sample collected from the subject.

9. A method of diagnosing breast cancer in a subject, comprising detecting the presence, in the subject, of a peptide encoded by a nucleic acid which hybridizes, under stringent conditions, to the region of the mouse mammary tumor virus env gene between residues 976 and 1640 and which does not hybridize to any other region of the mouse mammary tumor virus genome, by binding the peptide to an antibody according to claim 3.

10. The method of claim 9 wherein the presence of the peptide is detected in a sample collected from the subject.

11. A method of diagnosing breast cancer in a subject, comprising detecting the presence, in the subject, of a peptide related to mouse mammary tumor virus env protein by binding the peptide to an antibody according to claim 4.

12. The method of claim 1 wherein the presence of the peptide is detected in a sample collected from the subject.
——————————————————————————–

Description

——————————————————————————–

INTRODUCTION

The present invention relates to materials and methods for diagnosing breast cancer in humans. It is based, at least in part, on the discovery that a substantial percentage of human breast cancer tissue samples contained nucleic acid sequences corresponding to a portion of the mouse mammary tumor virus env gene. In contrast, such sequences were absent in almost all other human tissues tested.

BACKGROUND OF THE INVENTION

A large body of information has accumulated about the molecular biology of MMTV (reviewed in Slagle, B. L. et al., 1987, in “Cellular and Molecular Biology of Mammary Cancer”, Kidwell et al., eds., Plenum Press, NY. pp 275-306). Mouse mammary tumor virus (MMTV) is associated with a high incidence of breast cancer in certain strains of mice (over 90% among females), and has been regarded as a potential model for human disease.

The MMTV virus does not carry a transforming oncogene, but rather acts as an insertional mutagen with several proviral insertion loci designated int-1 or wnt-1 (Nusse R. et al., 1982, Cell 31:99-109) int-2 (Peters, G. et al., 1983, Cell 33:369-377) int-3 (Gallahan, D. et al., 1987, J. Virol. 61:218-220) int-4 (Roelink, H. et al., 1990, Proc. Natl. acad. Sci. USA 87:4519-4523) and int-5 (Morris, V. L., et al. 1991, Oncogene Research 6:53-63), which encode for growth factors or other related proteins. These genes are not expressed in normal mammary tissue but become activated after integration of MMTV provirus into the adjacent chromosomal DNA.

The human homolog of the int-2 locus has been located on chromosome 11 (Casey, G. et al., 1986, Mol. Cell Biol. 6:502-510) and has been found amplified (in 15% of the breast cancers) and also expressed (Lidereau, R. et al., 1988, Oncogene Res 2:285-291; Zhou, D. J. et al., 1988, Oncogene 2:279-282; Liscia, D. S. et al., 1989, Oncogene 4:1219-1224; Meyers, S. L. et al., 1990, Cancer Res 50:5911-5918). It may be significant that in tumors from Parsi women, who have a high incidence of breast tumors, the int-2 locus is amplified in 50% of the cases (Barnabas-Sohi, N. et al., 1993, Breast Dis. 6:13-26). The amplification of int-2 and other genes in 11q13 is indicative of poor prognosis (Schuwring, E. et al., 1992, Cancer Research 52:5229-5234; Champeme, M-H, et al., 1995, Genes, Chromosomes and Cancer 12:128-133). Both mouse and human int-2 have been sequenced (Moore, R. et al., 1986, EMBO J 5:919-924). The gene encodes a protein of about 27 kilodaltons (KD) which shows homology to both basic and acidic fibroblast growth factors (Dickson, C. et al. 1987, Nature (London) 326:833).

However, efforts to demonstrate the presence of viruses in human breast cancer through search for viral particles, immunological cross-reactivity, or sequence homology have yielded contradictory results. Detectable MMTV env gene-related antigenic reactivity has been found in tissue sections of breast cancer (Mesa-Tejada et al., 1978, Proc. Natl. Acad. Sci. USA 75:1529-1533; Levine, P. et al., 1980, Proc. Am. Assoc. Cancer Res. 21:170; Lloyd, R. et al., 1983, Cancer 51:654-661), breast cancer cells in culture (Litvinov, S. V. and Golovkina, T. V., 1989, Acta Virologica 33:137-142), human milk (Zotter S. et al., 1980, Eur. J. Cancer 16:455-467) in sera of patients (Day, N. K. et al., 1981, Proc. Natl. Acad. Sci. USA 78:2483-2487), in cyst fluid (Witkin, S. S. et al., 1981, J. Clin. Invest. 67:216-222) and in particles produced by a human breast carcinoma cell line (Keydar, I. et al., 1984, Proc. Natl. Acad. Sci. USA 81:4188-4192). Sequence homology to MMTV has been found in human DNA under low stringency conditions of hybridization (Callahan, R. et al., 1982, Proc. Natl. Acad. Sci. USA 79:5503-5507) and RNA related to MMTV has been detected in human breast cancer cells (Axel, R. et al., 1972, Nature 235:32-36). The presence of MMTV related sequences in lymphocytes from patients with breast cancer has been reported (Crepin, M. et al., 1984, Biochem. Biophys. Res. Comm. 118:324-331), as well as detection of reverse transcriptase (RT) activity in their monocytes (Al-Sumidaie, A. M. et al., 1988, Lancet 1:5-8). May and Westley (May and Westley, 1989, Cancer Research 49:3879-3883) have reported the presence of MMTV-like sequences arranged as tandem repeats only in DNA from breast cancer cells.

These results have been difficult to interpret, and theories linking MMTV or a related virus with human breast cancer have fallen out of favor, in view of the relatively recent discovery of human endogenous retroviral sequences (“HERs”; Westley, B. et al., 1986, J. Virol. 60:743-749; Ono, M. et al., 1986, J. Virol. 60:589-598; Faff, 0. et al., 1992, J. Gen. Virology 73:1087-1097). Data which could be interpreted to demonstrate the presence of MMTV-related sequences could be more readily explained by endogenous human retroviral sequences. Adding further confusion to the picture, env-gene related antigenicity has been detected in epitopes of human proteins (Hareuveni, M. et al., 1990, Int. J. Cancer 46:1134-1135).

SUMMARY OF THE INVENTION

The present invention relates to methods for diagnosing breast cancer in humans in which the presence of mouse mammary tumor virus env gene-like sequences bears a positive correlation to the existence of malignant breast disease. It is based, at least in part, on the discovery that 38 to 40 percent of human breast cancer tissue samples tested contained gene sequences homologous to the mouse mammary tumor virus env gene that are substantially absent from other human tumors and tissues. The invention also relates to methods for diagnosing breast caner in humans in which the presence of retrovirus proviral fragments substantially homologous to the env gene and/or 3′ LTR sequence of MMTV are detected. The molecular probes used in these experiments were designed to avoid cross-hybridization with endogenous human retroviral sequences. The present invention further provides for compositions of molecular probes which may be utilized in such diagnostic methods.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: Amplification of 660 bp of MMTV-like env gene. DNA was extracted from frozen tissues. PCR was performed using primers 1 and 3. A: 2% agarose gel electrophoresis. B: Southern blot hybridization using 5′.sup.32 P-end-labeled probe 2. Lanes 1 and 3: breast cancer; lanes 2 and 4: normal breast; lane 5: control reaction (no DNA); lane E: MMTV env gene. M: molecular weight marker. Arrow indicates 510 bp band.

FIG. 2: Nested PCR. A: 2% agarose gel electrophoresis. 1: Amplification of 686 bp of MMTV-like env gene sequences using primers 1 and 4 and the product of reaction A 1 as template. 2: Amplification of 250 bp of MMTV-like env gene sequences using primers 2 and 3. B, 1 and 2: Southern blot hybridization of the amplified products using probe 5′-.sup.32 P end-labeled probe 2a.

FIG. 3: Amplification of 250 bp of MMTV-like env gene. DNA was extracted from paraffin-embedded tissue sections. PCR was performed using primers 2 and 3. A: 2% agarose gel electrophoresis. B: Southern blot hybridization using 5′.sup.32 P-labeled probe 2a. Lane 1: normal breast; lanes 2 to 5: breast cancer; lane E: MMTV env gene. M: molecular weight marker. Arrow indicates 298 bp band.

FIG. 4: Nucleotide sequence of the cloned MMTV env gene-like sequences as compared to the env sequences of the GR and BR6 strains of MMTV using the GCG program. *:potential glycosylation site, .vertline.:mismatch to MMTV.

FIG. 5: Southern blot hybridization of genomic DNA. DNA was extracted from frozen tissues or cell lines, digested with EcoRl and transferred to nitrocellulose paper. Hybridization with .sup.32 P-labeled clone 166. DNA from A, B, and G: env gene positive breast cancer; C and D: env negative breast cancer; E and F: normal breast; H:MCF-7 cells. M: molecular weight marker, Arrow indicates 9 kb band.

FIG. 6: Southern blot hybridization of genomic DNA. Experimental conditions as in FIG. 5. DNA from A and B: env negative breast cancer; C and D: env positive breast cancer; E: molecular weight marker (non-labelled); F. to H: normal breast. Arrow indicates position of 9 kb marker.

FIG. 7: Map of MMTV.

FIG. 8: Comparison of the nucleic acid sequence of mouse mammary tumor env gene (“MMTENV”), showing residues 976-1640, with the nucleic acid sequence of a representative 660 bp sequence obtained by PCR reaction of DNA from human breast cancer tissue (“MS1627″).

FIG. 9: Sequence of an about 2.6 kb MMTV-like fragment detected in a human breast carcinoma.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to methods and compositions for diagnosing breast cancer in humans.

The present invention provides for compositions comprising an isolated and purified nucleic acid molecule which (i) hybridizes to a gene of mouse mammary tumor virus; (ii) is present in at least 20 percent of DNA samples prepared from breast cancer tissue of different human subjects; and (iii) is present in less than 5 percent of DNA samples prepared from tissues other than breast cancer tissue from different human subjects. A “gene of mouse mammary tumor virus” includes, but is not limited to, the gag, pol, and env genes and the 5′ LTR and 3′ LTR sequences of MMTV. In preferred embodiments of the invention, the mouse mammary tumor virus (hereafter “MMTV”) gene is the env gene and/or the 3′ LTR sequence. The term “hybridize” is used to refer to routine DNA-DNA or DNARNA hybridization techniques under what would be regarded, by the skilled artisan, as stringent hybridization conditions. The phrase “is present” indicates that a native form of the molecule, in an unpurified state (for example, as part of chromosomal DNA), may be detected by a standard laboratory technique, such as Southern blot or polymerase chain reaction (PCR). To be “present”, the molecule may be detectable by one technique but not others. To be present in “less than 5 percent of DNA samples prepared from tissues other than breast cancer tissue from different human subjects”, all non-breast cancer tissue samples are considered together, but the total number of samples must be large enough to give the 5 percent value statistical significance that would be reasonable to the skilled artisan.

In order to identify such a nucleic acid molecule, the sequence of MMTV may be compared, using a computer database, to known human DNA sequences, and portions of MMTV which are less than or equal to 25 percent homologous to a human sequence may be selected for further study. The term “homologous”, as used herein, refers to the presence of identical residues; for example, a first sequence is considered 25 percent homologous to a second sequence if it shares 25 percent of the residues of the first sequence. Since there is relatively greater likelihood that MMTV may bear similarity to human retroviral-like sequences, it may be preferable to evaluate whether a particular MMTV nucleic acid sequence is homologous to such sequences, for example, as endogenous human retrovirus sequences. A prototype of such viruses is HERV-K1O (Ono, M. et al., 1986, J. Virol. 60:589-598).

Once an MMTV gene sequence which is less than or equal to 25 percent homologous to a human DNA sequence, such as a human endogenous retroviral sequence, is identified, the presence of nucleic acid molecules having the MMTV gene sequence in human breast cancer tissues and other tissues may be evaluated. Such evaluations may be performed either by Southern blot techniques, or, preferably, by polymerase chain reaction (PCR) techniques, which are more sensitive. In such a way, MMTV gene sequences which (i) hybridize to at least 20 percent of DNA samples prepared from breast cancer tissue of different human subjects and (ii) hybridize to less than 5 percent of DNA samples prepared from human tissues other than breast cancer tissues may be identified. A nucleic acid molecule having a MMTV gene sequence which satisfies these requirements may then be used in diagnostic methods which detect the presence of such sequence in human breast tissue by standard techniques, including PCR techniques which assay for the presence of the molecule, but also, where appropriate, Southern blot, Northern blot, or Western blot techniques, to name but a few.

In preferred embodiments, the present invention relates to a portion of MMTV localized between MMTV env gene sequences 976 and 1640 (Majors, I. E. and Varmus, H. E., 1983, J. Virol. 47:495-504; see FIG. 7). This about 660 bp sequence (hereafter, “the 660 bp sequence”) has been found to exhibit low (16 percent) homology to the prototype human endogenous retrovirus HERV-K10, using the IBI/Pustell Sequence Analysis Program, and has also been shown to be present in 121 (38.5%) of 314 unselected breast cancer tissue samples, in cultured breast cancer cells, in 2 of 29 breast fibroadenomas (6.9%) and in 2 of 107 breast specimens from reduction mammoplasties (1.8%). The sequence was not found in normal tissues including breast, lymphocytes from breast cancer patients nor in other human cancers or cell lines (see example section, infra). Similarly, an about 250 bp sequence (hereafter “the 250 bp sequence”), between positions 1388 and 1640 in the env gene, and therefore falling within the 660 bp sequence, was detected in 60 (39.7%) of 151 breast cancer, and in one of 27 normal breast samples assayed from paraffin-embedded sections. Cloning and sequencing of the 660 bp and 250 bp sequences demonstrated that they are 95-99% homologous to MMTV env gene, but not to the known human endogenous retroviruses (“HERs”) nor to other viral or human genes (<18%).

In another preferred embodiment, the present invention relates to a a nucleic acid molecule which corresponds to a retroviral genomic fragment which has substantial homology to 3′ LTR and/or env gene of the MMTV genome, and is found in a substantial percentage of breast cancer samples. By substantial percentage is meant at least 20% of tested breast cancer samples. Such a sequence is preferably comprised of the 3′ LTR region and all or part of the env gene, although it may include more sequences of a retroviral genome. Most preferably, the sequence is at least comprised of an about 2.6 kb fragment which comprises the 1,228 base pair (bp) sequence of the 3′ LTR sequence and 1,336 bp of the env gene sequence of MMTV (FIG. 9) (SEQ ID NO:20). When compared with the two strains of MMTV C3H and BR6, the sequence homology was 90.8% and 90.7%, respectively. When compared with the endogenous retroviral sequences (HUMERKA), sequence homology was only 58% in 36 bp and 71% in 74 bp.

Retrovirus proviral sequences can be detected by PCR technology using primers derived from the MMTV genome. Such primers include primer 5L, containing the nucleotides 7376-7395 of the MMTV BR6 genome (5′-3′: CCAGATCGCCTTTAAGAAGG) (SEQ ID NO:11) and primer LTR3, containing nucleotides 9918-9927 of the MMTV BR6 genome (5′-3′: CGAACAGACACAAAGCGACG) (SEQ ID NO:19). Other primers which correspond to or are homologous to MMTV sequences can be used as primers. Nucleotide fragments which correspond to or are homologous to the retroviral sequences isolated from the breast cancer samples can also be used to amplify additional retroviral fragments from the samples. Long PCR techniques can be used to amplify longer stretches of a proviral sequence.

The present invention provides for compositions comprising an isolated and purified nucleic acid molecule which hybridizes to the about 2.6 kb retroviral fragment shown in FIG. 9 under stringent conditions or is at least 90 percent homologous to said fragment using the MacVector homology determining program which may be used to diagnose breast cancer in a subject, using methods which include PCR and Southern blot methods.

Nucleic acids having the 660 bp sequence, the 250 bp sequence, or all or part of the about 2.6 kb sequence, may therefore be used, according to the invention, to diagnose breast cancer in a subject, using methods which include PCR and Southern blot methods. Where PCR methods are used, primers such as those listed in Table 1, below, may be utilized.

The present invention provides for compositions comprising essentially purified and isolated nucleic acid having the 660 bp sequence or the 250 bp sequence or an at least five bp, and preferably greater than or equal to ten bp, subsequence thereof. In order to maintain the desired specificity, such nucleic acid molecules may preferably contain sequence falling within the 660 bp sequence, but preferably do not contain sequences from other portions of the MMTV genome, which may, undesirably, hybridize to human sequences which are not breast cancer specific, such as HERs. Accordingly, the present invention provides for compositions wherein the isolated and purified nucleic acid molecule comprises at least a portion having a nucleic acid sequence which hybridizes to a region of the mouse mammary tumor virus env gene between residues 976 and 1640, or between residues 1388 and 1640, and wherein the isolated and purified nucleic acid molecule does not hybridize to any other region of the MMTV genome.

The 660 bp sequence, in various embodiments, may have a number of nucleotide sequences. For example, in one embodiment, the 660 bp sequence may have a sequence as set forth in FIG. 8 and designated “MMTENV-like sequence” (SEQ ID NO:17), which depicts the MMTV env sequence between residues 976 and 1640. In a second series of embodiments, the 660 bp sequence may have a sequence as set forth in FIG. 8 and designated “MS1627″ (SEQ ID NO:18), which depicts a predominant sequence for the 660 bp sequence as it has been defined by sequencing analysis of the products of PCR reactions using DNA from human breast cancer tissues. In still further embodiments, the 660 bp sequence may have various other nucleotide sequences obtained by sequencing the results of PCR reactions to detect the presence of 660 bp sequence in human breast cancer tissues.

In related embodiments, the present invention provides for compositions comprising PCR primers that may be used to detect the presence of the forementioned molecules or other MMTV-like sequences. For example, the compositions may comprise one or more of the following primer molecules (5′-3′): CCTCACTGCCAGATC (SEQ ID NO:1); GGGAATTCCTCACTGCCAGATC (SEQ ID NO:2); CCTCACTGCCAGATCGCCT (SEQ ID NO:3); TACATCTGCCTGTGTTAC (SEQ ID NO:4); CCTACATCTGCCTGTGTTAC (SEQ ID NO:5); CCGCCATACGTGCTG (SEQ ID NO:6); ATCTGTGGCATACCT (SEQ ID NO:7); GGGAATTCATCTGTGGCATACCT (SEQ ID NO:8); ATCTGTGGCATACCTAAAGG (SEQ ID NO:9); GAATCGCTTGGCTCG (SEQ ID NO:10); CCAGATCGCCTTTAAGAAGG (SEQ ID NO:11); TACAGGTAGCAGCACGTATG (SEQ ID NO:12); CGAACAGACACAAACACACG (SEQ ID NO:19).

The use of such compositions and molecules in PCR and Southern blot techniques is illustrated in the non-limiting examples set forth below. The correlation between the presence of the MMTV-related nucleic acid molecules described above and breast cancer allows such molecules and compositions to be utilized in the diagnosis of breast cancer. Accordingly, the present invention provides for a method of diagnosing breast cancer, wherein the detection of such nucleic acid molecules bears a positive correlation to the existence of breast cancer in a human. The results of such evaluation, together with additional clinical symptoms, signs, and laboratory test values, may be used to formulate the complete diagnosis of the patient.

In further related embodiments, the present invention provides for an essentially purified peptide encoded by a nucleic acid molecule which (i) hybridizes to a gene of MMTV; (ii) is present in at least 20 percent of DNA samples prepared from breast cancer tissue of different human subjects; and (iii) is present in less than 5 percent of DNA samples prepared from tissues other than breast cancer tissue from different human subjects. In preferred embodiments, the MMTV gene is the env gene.

Such peptides may be used in the diagnosis of breast cancer. Accordingly, the present invention provides for a method of diagnosing breast cancer in a human subject, comprising detecting the presence of a peptide encoded by a nucleic acid molecule which (i) hybridizes to the env gene of a mouse mammary tumor virus; (ii) is present in at least 20 percent of DNA samples prepared from breast cancer tissue of different human subjects; and (iii) is present in less than 5 percent of DNA samples prepared from tissues other than breast cancer tissue from different human subjects.

The present invention also provides for antibodies (including monoclonal and polyclonal) antibodies which specifically bind to such peptides. Such antibodies may be used in methods of diagnosing breast cancer, for example, but not by way of limitation, by Western blot, immunofluorescent techniques, and so forth.

In nonlimiting embodiments of the invention, the skilled artisan may evaluate MMTV-like nucleic acid molecules for regions which would be considered likely to encode immunogenic peptides (using, for example, hydropathy plots). Such peptides may then be sequenced and used to produce antibodies that may be employed in diagnostic methods as set forth above.

For example, certain peptides encoded by portions of the 660 bp sequence have been synthesized. These peptides, which have the sequences LKRPGFQEHEMI (SEQ ID NO:13) and GLPHLIDIEKRG (SEQ ID NO:14), have been used to produce antibodies in rabbits, and the resulting antisera have successfully identified breast cancer cells positive for MMTV. env-like sequences by PCR assay. Other peptides encoded by 660 bp sequence which may be useful according to the invention include TNCLDSSAYDTA (SEQ ID NO:15) and DIGDEPWFDD (SEQ ID NO:16).

6. Example: The Detection of Mouse Mammary Tumor Virus Env Gene-Like Sequences in Human Breast Cancer Cells and Tissues

6.1. Materials and Methods

DNA from breast cancer tissue and other human cancer tissues, human placentas, normal human tissues including breast, and from several human cell lines (including eight breast cancer cell lines), and two normal breast cell lines was extracted following the procedure of Delli Bovi et al. (1986, Cancer Res. 46:6333-6338). The DNA was resuspended in a solution containing 0.05 M Tris HC1 buffer, pH 7.8, and 0.1 mM EDTA, and the amount of DNA recovered was determined by microfluorometry using Hoechst 33258 dye (Cesarone, C. et al., 1979, Anal Biochem 100:188-197). Plasmids containing the cloned genes of MMTV were obtained from the ATCC, propagated in Escherichia coli cultures and purified using anion-exchange minicolumns (Qiagen) or by precipitation with polyethylene glycol (Sambrook J., et al., 1989, in “Molecular Cloning/A Laboratory Manual”, Cold Spring Harbor). Oligonucleotide primers were synthesized at the core facilities of the Brookdale Molecular Biology Center at Mount Sinai School of Medicine.

Polymerase chain reaction (PCR) was performed using Taq polymerase following the conditions recommended by the manufacturer (Perkin Elmer Cetus) with regard to buffer, Mg.sup.2+ and nucleotide concentrations. Thermocycling was performed in a DNA cycler by denaturation at 94.degree. C. for 3 min. followed by either 35 or 50 cycles of 94.degree. C. for 1.5 min., 50.degree. C. for 2 min. and 72.degree. C. for 3 min. The ability of the PCR to amplify the selected regions of the MMTV env gene was tested by using as positive templates the cloned MMTV env gene and the genomic DNA of the MCF-7 cell line, since it was shown to express gp52 immunological determinants (Yang, N. S., et al., 1975, J. Natl. Cancer Inst. 61:1205-1208). Optimal Mg.sup.2+, primer concentrations and requirements for the different cycling temperatures were determined with these templates. The master mix as recommended by the manufacturer was used. To detect possible contamination of the master mix components, a reaction without template was routinely tested. .gamma. DNA and control primers provided by the manufacturer were used as control for polymerase activity. As an internal control, amplification of a 120 bp sequence estrogen receptor gene was assayed using primers designed and generously provided by Dr. Beth Schachter, (Mount Sinai School of Medicine, N.Y.). In addition, primers for actin 5 gene amplification were also used.

The product of the PCR was analyzed by electrophoresis in a 2% agarose gel. A 1 kb DNA ladder (Gibco BRL) was used to identify the size of the PCR product. To determine if the amplified sequences of the middle region of the 660 bp faithfully reproduced the sequences of the env gene of MMTV, an 18-mer sequence within the env gene was used as a probe for the 660 bp amplified sequence. The 18-mer probe was 5′ end-labeled with .sup.32 P-ATP using T4 polynucleotide kinase and purified by the NENSORB nucleic acid purification cartridge (NEN). Southern blot hybridization was performed using the conditions described by (Saiki et al.,1985, Science 230:1350-1354).

The product of the PCR (660 bp or 250 bp) was cloned directly from the reaction mixture into the TA cloning vector (Invitrogen) using the TA cloning kit and following the conditions recommended by the supplier. Direct cloning of the fragment isolated from the gel, was also performed. Plasmid DNA was purified by CsCl density gradient centrifugation or by precipitation with polyethylene glycol (Sambrook et al., 1989, in “Molecular Cloning/A Laboratory Manual”, Cold Spring Harbor), restricted with HindIII and EcoRl, electrophoresed in 2% agarose gels and transferred to nitrocellulose filters. Southern blot hybridization was carried out using a 5′-terminal labeled internal probe as described above. Cloning procedures were performed in laboratories totally separate from those where PCR was carried out. Automated DNA sequencing (using Applied Technology Sequencer Model 373A) was performed in the Brookdale Molecular Biology Center. Sequence homology was determined using the IBI MacVector GenBank and GCG Programs.

To prevent contamination of the samples, processing of human tissues was performed in a laminar flow hood. DNA extractions were done in a chemical hood located in a different room from that where PCR was performed. PCR assays were assembled in a biological hood provided with ultraviolet light. Aerosol resistant tips and dedicated positive-displacement pipettes were used throughout. All equipment used for PCR (microcentrifuge, electrophoresis apparatus, pipettors) was cleaned each time with 10% sodium hypochlorite to assure DNA decontamination (Prince and Andrus, 1992, Biotechniques 12:358-36). After the initial experiments were performed, the plasmid containing the MMTV env gene was frozen and never used again, to avoid contamination. However, to detect plasmid contamination from our own env gene clones, primers were designed to amplify plasmid sequences. All the authentic MMTV env positive samples were then tested and found negative for plasmid contamination.

Southern blotting and hybridization were performed as described (Southern, E. M., 1975, J. Mol. Biol. 98:503-517), using the 660 bp cloned sequences labeled by the random primer procedure (Feinberg, A. P., et al., 1983, Anal. Biochem. 132:6-13). Prehybridization and hybridization were performed in a solution containing 6.times.SSPE, 5% Denhardt’s, 0.5% SDS, 50% formamide, 100 .mu.g/ml denaturated salmon testis DNA, incubated for 18 hrs at 42.degree. C., followed by washings with 2.times.SSC and 0.5% SDS at room temperature and at 37.degree. C. and finally in 0.1.times.SSC with 0.5% SDS at 68.degree. C. for 30 min (Sambrook et al., 1989, in “Molecular Cloning/A Laboratory Manual”, Cold Spring Harbor). For paraffin-embedded tissue sections the conditions described by Wright and Manos (1990, in “PCR Protocols”, Innis et al., eds., Academic Press, pp. 153-158) were followed using primers designed to detect a 250 bp sequence.

6.2. Results

6.2.1. Selection of Specific MMTV Env Gene Sequences

A computer search for MMTV env gene homologous sequences was first performed, since sequence homology between the human endogenous retroviral sequences and MMTV had been described. The prototype of this group of human endogenous retroviruses is HERV-K10 (Ono, M. et al., 1986, J. Virol. 60:589-598). The sequences of the env gene of MMTV (Majors, I. E. and Varmus, H. E., 1983, J Virol 47:495-504) were aligned with sequences of the env gene of the human endogenous retrovirus HERV-K10 (Ono, M. et al., 1986, J. Virol. 60:589-598), using the IBI/Pustell Sequence Analysis Program. A region of 660 bp of low homology (16%) was localized between MMTV env gene sequences 976 and 1640 (Majors, I. E. and Varmus, H. E., 1983, J Virol 47:495-504). This internal domain of the outer membrane of the env gene has only one glycosylation site and is highly conserved between strains. Two primers comprising 15 bp sequences at positions 976-990 (primer 1) and 1626-1640 (primer 3) were first synthesized. Later longer primers were synthesized (1N and 3N). An 18-mer sequence in the middle of the 660 bp MMTV env region (1388-1405) (primer 2) was used as a probe to identify the 660 bp sequence. A second oligomer probe was synthesized comprising the sequence 1554 to 1568 (primer 2a) to be used for hybridization when a sequence of around 250 bp (between positions 1388 and 1640) was amplified. For nested PCR reactions (Mullis, K. B. and Faloona, F. A., 1987, Meth Enzymol 155:335-350), another primer comprising sequences 1647 to 1661 (primer 4) was synthesized to be used with primer 1 in the first reaction and primers 2 and 3 in the second. Modified primers with GC clamps and extra sequences were also synthesized and used in the PCR (primers 1a and 3a). Another set of primers comprising sequences 974 to 1003 (5L) and 1558 to 1577 (3L) were subsequently developed because their Tm’s matched and provided better amplification than the original primers. The sequences are represented in Table 1. All of them were productive in amplification reactions.

TABLE 1 ______________________________________ Primer and probe sequences and location in mouse mammary tumor virus env gene Designation Sequence (5′-3′) Location ______________________________________ 1 CCTCACTGCCAGATC 976-990 1a GGGAATTCCTCACTGCCAGATC 976-990 1N CCTCACTGCCAGATCGCCT 976-993 2 TACATCTGCCTGTGTTAC 1388-1405 2N CCTACATCTGCCTGTGTTAC 1386-1405 2a CCGCCATACGTGCTG 1554-1568 3 ATCTGTGGCATACCT 1640-1626 3a GGGAATTCATCTGTGGCATACCT 1640-1626 3N ATCTGTGGCATACCTAAAGG 1640-1621 4 GAATCGCTTGGCTCG 1661-1647 5L CCAGATCGCCTTTAAGAAGG 984-1003 3L TACAGGTAGCAGCACGTATG 1558-1577 ______________________________________

6.2.2. Detection of MMTV-Like Env Gene Seauences in Human Breast Tumor DNA

PCR was performed on DNA extracted from breast cancer tissues, normal breast tissues and from the plasmid containing the env gene of MMTV, using primers 1 and 3. Photographs of the ethidium bromide stained gels of the PCR product reveal the presence of an approximately 660 bp sequence in some of the tumors, (FIG. 1A, lanes 1 and 3) but not in the normal tissue samples (FIG. 1A, lanes 2 and 4). As a positive control the MMTV env gene was also amplified (FIG. 1A, lane E). Similar results were obtained with modified primers 1a, 3a, 3L and 5L. Southern blot hybridization of the gel with .sup.32 P-labeled 18-mer oligonucleotide (primer 2) indicated that this internal sequence was present in the amplified material (FIG. 1B) and that the bands in the gel were not artifactual.

Our initial effort was to analyze a representative sample of breast cancer specimens as well as normal tissues and other tumors. To date 343 breast tumors have been processed, DNA extracted and PCR preformed. Of these 343 tumors, 314 were carcinomas and 29 were fibroadenomas. Amplification of sequences of 660 bp was observed in 121 of the carcinomas (38.5%) and in 2 of the 29 fibroadenomas (6.9%). These sequences were confirmed to be MMTV env gene-like sequences by hybridization with the labeled specific probe containing the internal sequences. These sequences were not detected in the DNAs extracted from 20 normal organs, 23 cancers from other organs and 26 samples of blood lymphocytes including 7 from breast cancer patients whose breast specimens were positive. From 107 samples of normal breast obtained from reduction mammoplasties, 2 were positive (1.8%). In addition to DNA from lymphocytes from seven positive patients, DNA from their normal breast tissue of the operated breast was tested in 4 cases. All were negative (Table 2). Finally, DNA of the MCF-7, and ED (a cell line developed in our laboratory from the pleural effusion of a patient with an env -positive breast tumor) breast cancer cell lines were shown to contain the 660 bp MMTV env gene-like sequences (Table 3), while four other breast cancer cell lines were positive only for the 250 bp sequence (T47-D, BT-474, BT-20 and MDA-MB-231).

TABLE 2 ______________________________________ Detection of MMTV env gene-like sequences in human DNA extracted from fresh or frozen tissues MMTV env gene Sample Number sequences % Positive ______________________________________ Breast Carcinomas 314 121 38.5% Breast Fibroadenomas 29 2 6.9% Normal Breasts 107 2 1.8% *Normal Breasts 4 negative Tumors other than breast 23 negative Normal tissues 20 negative Lymphocytes 26 negative **Lymphocytes 7 negative ______________________________________ *Histologically normal tissue from same breast as positive cancer. **Lymphocytes from breast cancer patients who were positive for MMTV env gene sequences in the tumor.

TABLE 3 ______________________________________ Detection of MMTV env gene-like sequences in DNA from human cell lines in culture Human Cell Lines MMTV env gene sequence ______________________________________ MC-7 (breast carcinoma) positive T47-D (breast carcinoma) negative BT-20 (breast carcinoma) negative MDA-MB-231 (breast carcinoma) negative ZR-75-1 (breast carcinoma) negative SK-BR 3 (breast carcinoma) negative BT474 (breast carcinoma) negative ED (breast carcinoma) positive MCF-10 (normal breast) negative HB-447 (normal breast) negative HL-60 (promyelocytic leukemia) negative K562 (erythroleukemia) negative Jurkat (T cell leukemia) negative Hep 6-2 (hepatoma) negative ______________________________________

The nested polymerase reaction was used in several instances to increase sensitivity and specificity, thus reducing the probability of false positives. In FIG. 2, results of a representative nested reaction are shown using primers 1 and 4 in the first reaction (FIG. 2A) and 2 and 3 for the 2nd reaction. The specificity of the reaction can be seen in the 2nd amplification (FIG. 2B).

To study a large number of samples and to be able to perform archival studies, PCR of paraffin-embedded tissue sections was also carried out. Primers 2 and 3 were used to amplify a 250 bp sequence within the 660 bp stretch when DNA was extracted from paraffin-embedded tissue sections since larger size sequences are difficult to amplify after fixation. Tumor DNA was amplified (FIG. 3A, lanes 2-5) whereas normal breast DNA was not (FIG. 3A, lane 1). The identification of this 250 bp sequence with the MMTV-like env gene was confirmed by hybridization with an internal probe (primer 2a) as shown in FIG. 3B. Using this procedure we have analyzed 151 breast cancer samples and found that 60 (39.7%) possess the 250 bp sequence. Of the 27 normal breast samples obtained from reduction mammoplasties assayed by this procedure, one was positive (3.7%). These results, in conjunction with those obtained from lymphocytes and from normal breast tissue of patients whose breast cancer was PCR positive, indicate that MMTV-like sequences are present in a significant number of human breast cancer DNA which cannot be explained by DNA polymorphism.

6.2.3. Cloning and Sequencing of the MMTV-Like Env Gene Sequences

To find out whether there was homology to MMTV env gene throughout the whole 660 bp stretch, the product of the PCR from 8 different tumors was cloned and sequenced. In FIG. 4 the sequence of different clones comprising around 600 bp are represented, as aligned to the MMTV env gene sequence of the GR and BR6 strains (Redmon, S. and Dickson, C., 1983, EMBO J. 2:125-131). This domain of the env gene in the GR strain is 100% homologous to the C.sub.3 H strain and 98% to the BR6 strain (Majors, I. E. and Varmus, H. E., 1983, J. Virol. 47:495504; Moore, R. et al., 1987, J. Virol. 61:480-490). Evaluation of the clones indicated that homology to MMTV env gene varied from 95% to 99%. Another seven clones comprising only 250 bp were also sequenced. Homology to MMTV env gene varied from 95% to 99% (data not shown). When compared to the human endogenous provirus HERV-K10, the homology of all the clones was less than 15%. When compared against all known viral and human genes (more than 130,000 entries) using the lBl Macvector GenBank and GCG programs, the highest homology recorded was 18%.

6.2.4. Southern Blot Analysis Using Cloned Sequences

To investigate whether the env gene-like sequences were present in human DNA, Southern blot hybridization was performed using the cloned sequence as probe. DNAs from normal breast tissues, env positive or negative breast tumors, tumors other than breast and breast cancer cell lines were restricted with EcoRI and in some instances with Pstl, Bglll or Kpnl. EcoRl is a frequent cutter restriction enzyme that digests MMTV proviral DNA between env and pol genes. Four different cloned 660 bp sequences were used as probes after labeling with .sup.32 P by random prime-labeling. Results of some of the Southern blot hybridization experiments are shown in FIG. 5. They reveal the presence of a labeled restriction fragment migrating at approximately 7-8 kb in breast cancer DNA, in ED and two fragments in MCF-7 cells. Different restriction patterns were observed with the other three enzymes. The 660 bp sequence was absent in 10 normal tissues, 10 fibroadenomas and 10 tumors from other tissues. It is important to emphasize that hybridization conditions for these experiments were stringent (as described in Section 6.1) to avoid interference with endogenous sequences that might interact with the probes.

7. Example: Detection of a Retrovirus Proviral Fragment in Human Breast Cancer Cells and Tissues

7.1. Materials and Methods

To detect longer retrovirus proviral fragments in breast cancer samples, DNA was extracted from breast cancer carcinoma tissue samples as described above in Section 6.1. Two rounds of long PCR was performed on the DNA primers 5L (SEQ ID NO:11) and LTR3 (SEQ ID NO:19). The primer 5L contains nucleotides 7370-7395 of the MMTV BR6 genome (5′-3′: CCAGATCGCCTTTAAGAAGG) (SEQ ID NO:11) and primer LTR3 contains nucleotides 9918-9927 of the MMTV BR6 genome (5′-3′: CGAACAGACACAAAGCGACG) (SEQ ID NO:19). Long PCR was performed using protocols described by the manufacturer (Perkin Elmer, Foster City, Calif.). The amplified retroviral fragment isolated from the breast cancer sample was cloned into the TA cloning vector (Invitrogen) and automated sequencing and sequence analysis was performed as described in Section 6.1.

7.2 Results

An approximately 2.6 kb retroviral fragment containing 1,228 bp of the 3′ LTR sequence and 1,336 bp of the env gene sequence of a potential provirus was detected in a human breast carcinoma tissue sample by the long PCR technique using the 5L and LTR3 primers. The sequence of this retroviral fragment is shown in FIG. 9. (SEQ ID NO:20).

When compared with the two strains of MMTV C3H and BR6, the sequence homology was 90.8% and 90.7%, respectively, over the MMTV genomic fragment from nucleotides 7370-9937. When compared with the endogenous retroviral sequences (HUMERKA), sequence homology was only 58% in 36 bp and 71% in 74 bp.

Search for virus-related sequences in human breast cancer has been hampered by great variation reported in previous studies, by the presence of endogenous retroviral sequences in human DNA and by the lack of sensitivity of the methods employed. The studies reported herein circumvent these deficiencies by focusing on sequences with low homology to human endogenous retroviruses, by investigating a large number of tumors and several types of controls and by using the most sensitive technology presently available.

The results indicate that unique MMTV env gene sequences were present in 38.5% of the breast cancer samples analyzed and 39.7% of archival samples of breast cancer and that these sequences were absent in normal tissues including lymphocytes from patients with positive breast cancer and in cancers other than breast. Normal breast tissue and fibroadenomas had a low frequency (1.8 to 6.9%) of positive results. When cloned and sequenced, the sequences were found to be highly homologous to MMTV env gene, but not to the endogenous retroviral sequences. Furthermore, experiments in which the cloned amplified sequences were used for hybridization with DNA from breast cancer or normal tissues revealed that homologous DNA was only present in breast cancer DNA. The results also indicate that a human breast carcinoma sample contained an about 2.6 kb MMTV-like fragment comprised of 1,336 bp of the env gene and 1,228 bp of the 3′ LTR.

The detection of MMTV env gene sequences in two fibroadenomas out of 29 and in two normal breast tissue samples out of 107 samples is of uncertain significance. Although such results could potentially be artifactual, and thus may represent false positives, they may alternatively indicate the presence of histologically unrecognized cells that were or will be neoplastic.

Ninety percent (90%) of the breast cancers tested were invasive ductal carcinomas, which reflects the prevalence of this type of neoplasm. Most patients were node-positive which is probably artifactual since it was necessary that tumor size be sufficiently large to provide an aliquot for research and tumor size correlates with node positivity.

It is unlikely that differences in homology between MMTV env gene and the cloned human sequences are generated by errors committed by the Taq polymerase. It has been estimated that the rate of nucleotide misincorporation is 1.times.10.sup.-5 per cycle (Ehrlich et al, 1991, Science 252:1643-1651) and therefore, only a total of 0.32 nucleotides misincorporated should be expected in 660 bp after 50 cycles. The differences in homology between clones from different patients is likely to represent heterogeneity of the env gene.

In contrast to earlier, ambiguous data associating MMTV-like sequences with human breast cancer, we have clearly demonstrated the existence of such sequences in breast cancer cells which cannot be explained by any known human endogenous retroviral sequence. Our data do not support the results of earlier studies which indicated that, as in the mouse, MMTV-like sequences were found in lymphocytes from two patients with breast cancer (Crepin, M. et al., 1984, Biochem. Biophys. Res. Comm. 118:324-331). The absence of MMTV env-like sequences in lymphocytes could reflect the fate of a unique lymphocyte subset over decades between initial encounter and the appearance of clinical breast cancer; alternatively, the human disease may differ from the mouse model. Results from attempts to identify unique MMTV-like pol gene sequences have shown that they cannot be distinguished from the reverse transcriptase sequences of endogenous retroviruses (Deen, K. C. and Sweet, R. W., 1986, J. Virol. 57:422-432).

The origin of the MMTV env gene-like and 3′ LTRlike sequences found in tumor DNA could be the result of integrated MMTV-like sequences from a human mammary tumor virus. Polymorphism of endogenous retroviral sequences is conceivable but can be ruled out because these sequences were not detected in lymphocytes from the positive patients, in sections of the cancerous breast from which abnormal cells were absent, or in normal breast tissue from patients with MMTV env-like positive tumors. Recombination during tumorigenesis between endogenous sequences to resemble the MMTV env genes seems highly unlikely since no known gene or viral sequence is more than 18% homologous to the 660 bp sequence. The longer about 2.6 kb MMTV-like fragment detected in a human breast carcinoma had minimal homology (58% in 36 bp nd 71% in 74 bp) to endogenous human retroviral sequences. Thus, the most conservative interpretation is that our findings represent exogenous sequences from an agent similar to MMTV. Recombination between endogenous and exogenous env gene sequences are known to accelerate the development of malignancies in mice (DiFronzo, N. L. and Holland, C. A., 1993, J. Virol. 67:3763-3770). Whether the MMTV-like sequences belong to an entire acquired provirus or to an exogenous fragment integrated into endogenous sequences, is presently not known. Experiments are in progress to distinguish between these possibilities.

Several genetic alterations have been identified in human breast cancer that can be useful as markers for prevention, detection or prognosis (reviewed in Runnenbaum, I. et al., 1991, Proc. Natl. Acad. Sci. USA 88:10657-10661). The BRCAl and BRCA2 genes have recently been described. They account for at least 5% of breast cancer and are related to familial breast cancer (Miki, Y. et al., 1994, Science 266:66-71; Wooster, R. et al., 1994, Science 265:2088-2090). We have primary evidence that familial clustering of the MMTV env gene-like sequences occurs, accounting for an even higher percentage of cancers in affected families (Holland et al. 1994, Proc. Am. Assoc. Cancer Res 35:218). The presence of MMTV-like sequences may be correlated with special clinical disease status, may provide another potential molecular marker, and may distinguish a subset of human breast cancer for which viral etiology is tenable. This has implications for epidemiology, therapy and prevention.

Various publications are cited herein, the contents of which are hereby incorporated by reference in their entireties.

Comments (0)

Chromosome 13-linked breast cancer susceptibility gene

Filed under: Issued Patent — admin @ 3:17 am

Abstract
The present invention relates generally to the field of human genetics. Specifically, the present invention relates to methods and materials used to isolate and detect a human breast cancer predisposing gene (BRCA2), some mutant alleles of which cause susceptibility to cancer, in particular breast cancer. More specifically, the invention relates to germline mutations in the BRCA2 gene and their use in the diagnosis of predisposition to breast cancer. The present invention further relates to somatic mutations in the BRCA2 gene in human breast cancer and their use in the diagnosis and prognosis of human breast cancer. Additionally, the invention relates to somatic mutations in the BRCA2 gene in other human cancers and their use in the diagnosis and prognosis of human cancers. The invention also relates to the therapy of human cancers which have a mutation in the BRCA2 gene, including gene therapy, protein replacement therapy and protein mimetics. The invention further relates to the screening of drugs for cancer therapy. Finally, the invention relates to the screening of the BRCA2 gene for mutations, which are useful for diagnosing the predisposition to breast cancer.

——————————————————————————–
Inventors: Tavtigian; Sean V. (Salt Lake City, UT), Kamb; Alexander (Salt Lake City, UT), Simard; Jacques (St. Augustin de Desmuures, CA), Couch; Fergus (St. Davids, PA), Rommens; Johanna M. (Toronto, CA), Weber; Barbara L. (Merion, PA)
Assignee: Myriad Genetics, Inc. (Salt Lake City, UT)
Endo Recherche, Inc. (CA)
HSC Research & Development Limited Parntership (CA)
Trustees of the Univ. of Pennsylvania (Philadelphia, PA)

Appl. No.: 09/044,946
Filed: March 20, 1998
Abstract
The present invention relates generally to the field of human genetics. Specifically, the present invention relates to methods and materials used to isolate and detect a human breast cancer predisposing gene (BRCA2), some mutant alleles of which cause susceptibility to cancer, in particular breast cancer. More specifically, the invention relates to germline mutations in the BRCA2 gene and their use in the diagnosis of predisposition to breast cancer. The present invention further relates to somatic mutations in the BRCA2 gene in human breast cancer and their use in the diagnosis and prognosis of human breast cancer. Additionally, the invention relates to somatic mutations in the BRCA2 gene in other human cancers and their use in the diagnosis and prognosis of human cancers. The invention also relates to the therapy of human cancers which have a mutation in the BRCA2 gene, including gene therapy, protein replacement therapy and protein mimetics. The invention further relates to the screening of drugs for cancer therapy. Finally, the invention relates to the screening of the BRCA2 gene for mutations, which are useful for diagnosing the predisposition to breast cancer.

Appl. No.: 09/044,946
Filed: March 20, 1998
Parent Case Text

——————————————————————————–

CROSS REFERENCE TO RELATED APPLICATION

This application is a divisional of application Ser. No. 08/639,501, U.S. Pat. No. 5,837,492; filed on Apr. 29, 1996, U.S. Pat. No. 5,837,492; which is a continuation-in-part of application Ser. No. 08/585,391, filed on Jan. 11, 1996, now abandoned; which is a continuation-in-part of application Ser. No. 08/576,559 filed on Dec. 21, 1995, now abandoned; which is a continuation-in-part of application Ser. No. 08/575,359, filed on Dec. 20, 1995, now abandoned; which is a continuation-in-part of application Ser. No. 08/573,779, filed on Dec. 18, 1995, now abandoned; all of which are incorporated herein by reference.
——————————————————————————–

Claims

——————————————————————————–

What is claimed is:

1. A method for identifying a mutant BRCA2 nucleotide sequence in a suspected mutant BRCA2 allele which comprises comparing the nucleotide sequence of the suspected mutant BRCA2 allele with the wild-type BRCA2 nucleotide sequence, wherein a difference between the suspected mutant and the wild-type sequences identifies a mutant BRCA2 nucleotide sequence.

2. A method for diagnosing a predisposition for breast cancer in a human subject which comprises comparing the germline sequence of the BRCA2 gene or the sequence of its mRNA in a tissue sample from said subject with the germline sequence of the wild-type BRCA2 gene or the sequence of its mRNA, wherein an alteration in the germline sequence of the BRCA2 gene or the sequence of its mRNA of the subject indicates a predisposition to said cancer.

3. The method of claim 2 wherein an alteration is detected in a regulatory region of the BRCA2 gene.

4. The method of claim 2 wherein the detection in the alteration in the germline sequence is determined by an assay selected from the group consisting of (a) observing shifts in electrophoretic mobility of single-stranded DNA on non-denaturing polyacrylamide gels, (b) hybridizing a BRCA2 gene probe to genomic DNA isolated from said tissue sample, (c) hybridizing an allele-specific probe to genomic DNA of the tissue sample, (d) amplifying all or part of the BRCA2 gene from said tissue sample to produce an amplified sequence and sequencing the amplified sequence, (e) amplifying all or part of the BRCA2 gene from said tissue sample using primers for a specific BRCA2 mutant allele, (f) molecularly cloning all or part of the BRCA2 gene from said tissue sample to produce a cloned sequence and sequencing the cloned sequence, (g) identifying a mismatch between (1) a BRCA2 gene or a BRCA2 mRNA isolated from said tissue sample, and (2) a nucleic acid probe complementary to the human wild-type BRCA2 gene sequence, when molecules (1) and (2) are hybridized to each other to form a duplex, (h) amplification of BRCA2 gene sequences in said tissue sample and hybridization of the amplified sequences to nucleic acid probes which comprise wild-type BRCA2 gene sequences, (i) amplification of BRCA2 gene sequences in said tissue sample and hybridization of the amplified sequences to nucleic acid probes which comprise mutant BRCA2 gene sequences, (j) screening for a deletion mutation in said tissue sample, (k) screening for a point mutation in said tissue sample, (l) screening for an insertion mutation in said tissue sample, (m) in situ hybridization of the BRCA2 gene of said tissue sample with nucleic acid probes which comprise the BRCA2 gene.

5. A method for detecting a mutation in a neoplastic lesion at the BRCA2 gene in a human subject which comprises comparing the sequence of the BRCA2 gene or the sequence of its mRNA in a tissue sample from a lesion of said subject with the sequence of the wild-type BRCA2 gene or the sequence of its mRNA, wherein an alteration in the sequence of the BRCA2 gene or the sequence of its mRNA of the subject indicates a mutation at the BRCA2 gene of the neoplastic lesion.

6. The method of claim 5 wherein an alteration is detected in the a regulatory regions of the BRCA2 gene.

7. The method of claim 5 wherein the detection in the alteration in the BRCA2 sequence is determined by an assay selected from the group consisting of (a) observing shifts in electrophoretic mobility of single-stranded DNA on non-denaturing polyacrylamide gels, (b) hybridizing a BRCA2 gene probe to DNA isolated from said tissue sample, (c) hybridizing an allele-specific probe to DNA of the tissue sample, (d) amplifying all or part of the BRCA2 gene from said tissue sample to produce an amplified sequence and sequencing the amplified sequence, (e) amplifying all or part of the BRCA2 gene from said tissue sample using primers for a specific BRCA2 mutant allele, (f) molecularly cloning all or part of the BRCA2 gene from said tissue sample to produce a cloned sequence and sequencing the cloned sequence, (g) identifying a mismatch between (1) a BRCA2 gene or a BRCA2 mRNA isolated from said tissue sample, and (2) a nucleic acid probe complementary to the human wild-type BRCA2 gene sequence, when molecules (1) and (2) are hybridized to each other to form a duplex, (h) amplification of BRCA2 gene sequences in said tissue sample and hybridization of the amplified sequences to nucleic acid probes which comprise wild-type BRCA2 gene sequences, (i) amplification of BRCA2 gene sequences in said tissue sample and hybridization of the amplified sequences to nucleic acid probes which comprise mutant BRCA2 gene sequences., (0) screening for a deletion mutation in said tissue sample, (k) screening for a point mutation in said tissue sample, (1) screening for an insertion mutation in said tissue sample, (m) in situ hybridization of the BRCA2 gene of said tissue sample with nucleic acid probes which comprise the BRCA2 gene.

8. A method for confirming the lack of a BRCA2 mutation in a neoplastic lesion from a human subject which comprises comparing the sequence of the BRCA2 gene or the sequence of its mRNA in a tissue sample from a lesion of said subject with the sequence of the wild-type BRCA2 gene or the sequence of its RNA, wherein the presence of the wild-type sequence in the tissue sample indicates the lack of a mutation at the BRCA2 gene.
——————————————————————————–

Description

——————————————————————————–

FIELD OF THE INVENTION

The present invention relates generally to the field of human genetics. Specifically, the present invention relates to methods and materials used to isolate and detect a human cancer as predisposing gene (BRCA2), some mutant alleles of which cause susceptibility to cancer, in particular, breast cancer in females and males. More specifically, the invention relates to germline mutations in the BRCA2 gene and their use in the diagnosis of predisposition to breast cancer. The present invention further relates to somatic mutations in the BRCA2 gene in human breast cancer and their use in the diagnosis and prognosis of human breast cancer. Additionally, the invention relates to somatic mutations in the BRCA2 gene in other human cancers and their use in the diagnosis and prognosis of human cancers. The invention also relates to the therapy of human cancers which have a mutation in the BRCA2 gene, including gene therapy, protein replacement therapy and protein mimetics. The invention further relates to the screening of drugs for cancer therapy. Finally, the invention relates to the screening of the BRCA2 gene for mutations, which are useful for diagnosing the predisposition to breast cancer.

The publications and other materials used herein to illuminate the background of the invention, and in particular, cases to provide additional details respecting the practice, are incorporated herein by reference, and for convenience, are referenced by author and date in the following text and respectively grouped in the appended List of References.

BACKGROUND OF THE INVENTION

The genetics of cancer is complicated, involving multiple dominant, positive regulators of the transformed state (oncogenes) as well as multiple recessive, negative regulators (tumor suppressor genes). Over one hundred oncogenes have been characterized. Fewer than a dozen tumor suppressor genes have been identified, but the number is expected to increase beyond fifty (Knudson, 1993).

The involvement of so many genes underscores the complexity of the growth control mechanisms that operate in cells to maintain the integrity of normal tissue. This complexity is manifest in another way. So far, no single gene has been shown to participate in the development of all, or even the majority of human cancers. The most common oncogenic mutations are in the H-ras gene, found in 10-15% of all solid tumors (Anderson et al., 1992). The most frequently mutated tumor suppressor genes are the TP53 gene, homozygously deleted in roughly 50% of all tumors, and CDKN2, which was homozygously deleted in 46% of tumor cell lines examined (Kamb et al., 1994a). Without a target that is common to all transformed cells, the dream of a “magic bullet” that can destroy or revert cancer cells while leaving normal tissue unharmed is improbable. The hope for a new generation of specifically targeted antitumor drugs may rest on the ability to identify tumor suppressor genes or oncogenes that play general roles in control of cell division.

The tumor suppressor genes which have been cloned and characterized influence susceptibility to: 1) Retinoblastoma (RB1); 2) Wilms’ tumor (WT1); 3) Li-Fraumeni (TP53); 4) Familial adenomatous polyposis (APC); 5) Neurofibromatosis type 1 (NF1); 6) Neurofibromatosis type 2 (NF2); 7) von Hippel-Lindau syndrome (VHL); Multiple endocrine neoplasia type 2A (MEN2A), and 9) Melanoma (CDKN2).

Tumor suppressor loci that have been mapped genetically but not yet isolated include genes for: Multiple endocrine neoplasia type 1 (MEN1); Lynch cancer family syndrome 2 (LCFS2); Neuroblastoma (NB); Basal cell nevus syndrome (BCNS); Beckwith-Wiedemann syndrome (BWS); Renal cell carcinoma (RCC); Tuberous sclerosis 1 (TSC1); and Tuberous sclerosis 2 (TSC2). The tumor suppressor genes that have been characterized to date encode products with similarities to a variety of protein types, including DNA binding proteins (WT1), ancillary transcription regulators (RB1), GTPase activating proteins or GAPs (NF1), cytoskeletal components (NF2), membrane bound receptor kinases (MEN2A), cell cycle regulators (CDKN2) and others with no obvious similarity to known proteins (APC and VHL).

In many cases, the tumor suppressor gene originally identified through genetic studies has been shown to be lost or mutated in some sporadic tumors. This result suggests that regions of chromosomal aberration may signify the position of important tumor suppressor genes involved both in genetic predisposition to cancer and in sporadic cancer.

One of the hallmarks of several tumor suppressor genes characterized to date is that they are deleted at high frequency in certain tumor types. The deletions often involve loss of a single allele, a so-called loss of heterozygosity (LOH), but may also involve homozygous deletion of both alleles. For LOH, the remaining allele is presumed to be nonfunctional, either because of a preexisting inherited mutation, or because of a secondary sporadic mutation. Breast cancer is one of the most significant diseases that affects women. At the current rate, American women have a 1 in 8 risk of developing breast cancer by age 95 (American Cancer Society, 1992). Treatment of breast cancer at later stages is often futile and disfiguring, making early detection a high priority in medical management of the disease. Ovarian cancer, although less frequent than breast cancer, is often rapidly fatal and is the fourth most common cause of cancer mortality in American women. Genetic factors contribute to an ill-defined proportion of breast cancer incidence, estimated to be about 5% of all cases but approximately 25% of cases diagnosed before age 40 (Claus el al., 1991). Breast cancer has been subdivided into two types, early-age onset and late-age onset, based on an inflection in the age-specific incidence curve around age 50. Mutation of one gene, BRCA1, is thought to account for approximately 45% of familial breast cancer, but at least 80% of families with both breast and ovarian cancer (Easton et al., 1993).

The BRCA1 gene has been isolated (Futreal et al., 1994; Miki et al., 1994) following an intense effort following its mapping in 1990 (Hall et al., 1990; Narod et al., 1991). A second locus, BRCA2, has recently been mapped to chromosome 13 (Wooster et al., 1994) and appears to account for a proportion of early-onset breast cancer roughly equal to BRCA1, but confers a lower risk of ovarian cancer. The remaining susceptibility to early-onset breast cancer is divided between as-yet unmapped genes for familial cancer, and rarer germline mutations in genes such as TP53 (Malkin et al., 1990). It has also been suggested that heterozygote carriers for defective forms of the Ataxia-Telangiectasia gene are at higher risk for breast cancer (Swift et al., 1976; Swift el al., 1991). Late-age onset breast cancer is also often familial although the risks in relatives are not as high as those for early-onset breast cancer (Cannon-Albright et al., 1994; Mettlin et al., 1990). However, the percentage of such cases due to genetic susceptibility is unknown.

Breast cancer has long been recognized to be, in part, a familial disease (Anderson, 1972). Numerous investigators have examined the evidence for genetic inheritance and concluded that the data are most consistent with dominant inheritance for a major susceptibility locus or loci (Bishop and Gardner, 1980; Go et al., 1983; Williams and Anderson, 1984; Bishop et al., 1988; Newman et al., 1988; Claus et al., 1991). Recent results demonstrate that at least three loci exist which convey susceptibility to breast cancer as well as other cancers. These loci are the TP53 locus on chromosome 17p (Malkin et al., 1990), a 17q-linked susceptibility locus known as BRCA1 (Hall et al., 1990), and one or more loci responsible for the unmapped residual. Hall et al. (1990) indicated that the inherited breast cancer susceptibility in kindreds with early age onset is linked to chromosome 17q21; although subsequent studies by this group using a more appropriate genetic model partially refuted the limitation to early onset breast cancer (Margaritte et al., 1992).

Most strategies for cloning the chromosome 13-linked breast cancer predisposing gene (BRCA2) require precise genetic localization studies. The simplest model for the functional role of BRCA2 holds that alleles of BRCA2 that predispose to cancer are recessive to wild type alleles; that is, cells that contain at least one wild type BRCA2 allele are not cancerous. However, cells that contain one wild type BRCA2 allele and one predisposing allele may occasionally suffer loss of the wild type allele either by random mutation or by chromosome loss during cell division (nondisjunction). All the progeny of such a mutant cell lack the wild type function of BRCA2 and may develop into tumors. According to this model, predisposing alleles of BRCA2 are recessive, yet susceptibility to cancer is inherited in a dominant fashion: women who possess one predisposing allele (and one wild type allele) risk developing cancer, because their mammary epithelial cells may spontaneously lose the wild type BRCA2 allele. This model applies to a group of cancer susceptibility loci known as tumor suppressors or antioncogenes, a class of genes that includes the retinoblastoma gene and neurofibromatosis gene. By inference this model may explain the BRCA1 function, as has recently been suggested (Smith et al., 1992).

A second possibility is that BRCA2 predisposing alleles are truly dominant; that is, a wild type allele of BRCA2 cannot overcome the tumor forming role of the predisposing allele. Thus, a cell that carries both wild type and mutant alleles would not necessarily lose the wild type copy of BRCA2 before giving rise to malignant cells. Instead, mammary cells in predisposed individuals would undergo some other stochastic change(s) leading to cancer.

If BRCA2 predisposing alleles are recessive, the BRCA2 gene is expected to be expressed in normal mammary tissue but not functionally expressed in mammary tumors. In contrast, if BRCA2 predisposing alleles are dominant, the wild type BRCA2 gene may or may not be expressed in normal mammary tissue. However, the predisposing allele will likely be expressed in breast tumor cells.

The chromosome 13 linkage of BRCA2 was independently confirmed by studying fifteen families that had multiple cases of early-onset breast cancer cases that were not linked to BRCA1 (Wooster et al., 1994). These studies claimed to localize the gene within a large region, 6 centiMorgans (cM), or approximately 6 million base pairs, between the markers D13S289 and D13S267, placing BRCA2 in a physical region defined by 13q12-13. The size of these regions and the uncertainty associated with them has made it difficult to design and implement physical mapping and/or cloning strategies for isolating the BRCA2 gene. Like BRCA1, BRCA2 appears to confer a high risk of early-onset breast cancer in females. However, BRCA2 does not appear to confer a substantially elevated risk of ovarian cancer, although it does appear to confer an elevated risk of male breast cancer (Wooster, et al., 1994).

Identification of a breast cancer susceptibility locus would permit the early detection of susceptible individuals and greatly increase our ability to understand the initial steps which lead to cancer. As susceptibility loci are often altered during tumor progression, cloning these genes could also be important in the development of better diagnostic and prognostic products, as well as better cancer therapies.

SUMMARY OF THE INVENTION

The present invention relates generally to the field of human genetics. Specifically, the present invention relates to methods and materials used to isolate and detect a human breast cancer predisposing gene (BRCA2), some alleles of which cause susceptibility to cancer, in particular breast cancer in females and males. More specifically, the present invention relates to germline mutations in the BRCA2 gene and their use in the diagnosis of predisposition to breast cancer. The invention further relates to somatic mutations in the BRCA2 gene in human breast cancer and their use in the diagnosis and prognosis of human breast cancer. Additionally, the invention relates to somatic mutations in the BRCA2 gene in other human cancers and their use in the diagnosis and prognosis of human cancers. The invention also relates to the therapy of human cancers which have a mutation in the BRCA2 gene, including gene therapy, protein replacement therapy and protein mimetics. The invention further relates to the screening of drugs for cancer therapy. Finally, the invention relates to the screening of the BRCA2 gene for mutations, which are useful for diagnosing the predisposition to breast cancer.

BRIEF DESCRIPTION OF THF DRAWINGS

FIG. 1 shows a schematic map of STSs, P1s, BACs and YACs in the BRCA2 region.

FIG. 2 shows the sequence-space relationship between the cDNA clones, hybrid selected clones, cDNA PCR products and genomic sequences used to assemble the BRCA2 transcript sequence. 2-Br-C:RACE is a biotin-capture RACE product obtained from both human breast and human thymus cDNA. The cDNA clone .lambda. sC713.1 was identified by screening a pool of human testis and HepG2 cDNA libraries with hybrid selected clone GT 713. The sequence 1-BR:CG026 .fwdarw.5 kb was generated from a PCR product beginning at the exon 7/8 junction (within .lambda. sC713.1) and terminating within an hybrid selected clone that is part of exon 11. The sequence of exon 11 was corrected by comparison to hybrid selected clones, genomic sequence in the public domain and radioactive DNA sequencing gels. Hybrid selected clones located within that exon (clone names beginning with nH or GT) are placed below it. The cDNA clones .lambda. wCBF1B8.1, .lambda. wCBF1A5.1, .lambda. wCBF1 A5.12, .lambda. wCBF1B6.2 and .lambda. wCBF1B6.3 were identified by screening a pool of human mammary gland, placenta, testis and HepG2 cDNA libraries with the exon trapped clones wXBF1B8, wXPF1A5 and wXBF1B6. The clone .lambda. wCBF1B6.3 is chimeric (indicated by the dashed line), but its 5′ end contained an important overlap with .lambda. wCBF1A5.1. denotes the translation initiator. denotes the translation terminator.

FIGS. 3A-3D show the DNA sequence of the BRCA2 gene (which is also set forth in SEQ ID NO:1).

FIG. 4 shows the genomic organization of the BRCA2 gene. The exons (boxes and/or vertical lines) are parsed across the genomic sequences (ftp://genome.wustl.edu/pub/gscl/brca;) (horizontal lines) such that their sizes and spacing are proportional. The name of each genomic sequence is given at the left side of the figure. The sequences 92M18.00541 and 92M18.01289 actually overlap. Distances between the other genomic sequences are not known. Neither the public database nor our sequence database contained genomic sequences overlapping with exon 21.

Exons 1, 11 and 21 are numbered. “*” denotes two adjacent exons spaced closely enough that they are not resolved at this scale.

FIGS. 5A-5D show a loss of heterozygosity (LOH) analysis of primary breast tumors. Alleles of STR markers are indicated below the chromatogram. Shown are one example of a tumor heterozygous at BRCA2 (FIGS. 5A and 5B) and an example of a tumor with LOH at BRCA2 (FIGS. 5C and 5D). Fluorescence units are on the ordinate; size in basepairs is on the abscissa. N is for normal (FIGS. 5A and 5C) and T is for tumor (FIGS. 5B and 5D).

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an isolated polynucleotide comprising all, or a portion of the BRCA2 locus or of a mutated BRCA2 locus, preferably at least eight bases and not more than about 100 kb in length. Such polynucleotides may be antisense polynucleotides. The present invention also provides a recombinant construct comprising such an isolated polynucleotide, for example, a recombinant construct suitable for expression in a transformed host cell.

Also provided by the present invention are methods of detecting a polynucleotide comprising a portion of the BRCA2 locus or its expression product in an analyte. Such methods may further comprise the step of amplifying the portion of the BRCA2 locus, and may further include a step of providing a set of polynucleotides which are primers for amplification of said portion of the BRCA2 locus. The method is useful for either diagnosis of the predisposition to cancer or the diagnosis or prognosis of cancer.

The present invention also provides isolated antibodies, preferably monoclonal antibodies, which specifically bind to an isolated polypeptide comprised of at least five amino acid residues encoded by the BRCA2 locus.

The present invention also provides kits for detecting in an analyte a polynucleotide comprising a portion of the BRCA2 locus, the kits comprising a polynucleotide complementary to the portion of the BRCA2 locus packaged in a suitable container, and instructions for its use.

The present invention further provides methods of preparing a polynucleotide comprising polymerizing nucleotides to yield a sequence comprised of at least eight consecutive nucleotides of the BRCA2 locus; and methods of preparing a polypeptide comprising polymerizing amino acids to yield a sequence comprising at least five amino acids encoded within the BRCA2 locus.

The present invention further provides methods of screening the BRCA2 gene to identify mutations. Such methods may further comprise the step of amplifying a portion of the BRCA2 locus, and may further include a step of providing a set of polynucleotides which are primers for amplification of said portion of the BRCA2 locus. The method is useful for identifying mutations for use in either diagnosis of the predisposition to cancer or the diagnosis or prognosis of cancer.

The present invention further provides methods of screening suspected BRCA2 mutant alleles to identify mutations in the BRCA2 gene.

In addition, the present invention provides methods of screening drugs for cancer therapy to identify suitable drugs for restoring BRCA2 gene product function.

Finally, the present invention provides the means necessary for production of gene-based therapies directed at cancer cells. These therapeutic agents may take the form of polynucleotides comprising all or a portion of the BRCA2 locus placed in appropriate vectors or delivered to target cells in more direct ways such that the function of the BRCA2 protein is reconstituted. Therapeutic agents may also take the form of polypeptides based on either a portion of, or the entire protein sequence of BRCA2. These may functionally replace the activity of BRCA2 in vivo.

It is a discovery of the present invention that the BRCA2 locus which predisposes individuals to breast cancer, is a gene encoding a BRCA2 protein. This gene is termed BRCA2 herein. It is a discovery of the present invention that mutations in the BRCA2 locus in the germline are indicative of a predisposition to breast cancer in both men and women. Finally, it is a discovery of the present invention that somatic mutations in the BRCA2 locus are also associated with breast cancer and other cancers, which represents an indicator of these cancers or of the prognosis of these cancers. The mutational events of the BRCA2 locus can involve deletions, insertions and point mutations within the coding sequence and the non-coding sequence.

Starting from a region on human chromosome 13 of the human genome, which has a size estimated at about 6 million base pairs, a smaller region of 1 to 1.5 million bases which contains a genetic locus, BRCA2, which causes susceptibility to cancer, including breast cancer, has been identified.

The region containing the BRCA2 locus was identified using a variety of genetic techniques. Genetic mapping techniques initially defined the BRCA2 region in terms of recombination with genetic markers. Based upon studies of large extended families (“kindreds”) with multiple cases of breast cancer, a chromosomal region has been pinpointed that contains the BRCA2 gene. A region which contains the BRCA2 locus is physically bounded by the markers D13S289 and D13S267.

The use of the genetic markers provided by this invention allowed the identification of clones which cover the region from a human yeast artificial chromosome (YAC) or a human bacterial artificial chromosome (BAC) library. It also allowed for the identification and preparation of more easily manipulated P1 and BAC clones from this region and the construction of a contig from a subset of the clones. These P1s, YACs and BACs provide the basis for cloning the BRCA2 locus and provide the basis for developing reagents effective, for example, in the diagnosis and treatment of breast and/or ovarian cancer. The BRCA2 gene and other potential susceptibility genes have been isolated from this region. The isolation was done using software trapping (a computational method for identifying sequences likely to contain coding exons, from contiguous or discontinuous genomic DNA sequences), hybrid selection techniques and direct screening, with whole or partial cDNA inserts from P1s and BACs, in the region to screen cDNA libraries. These methods were used to obtain sequences of loci expressed in breast and other tissue. These candidate loci were analyzed to identify sequences which confer cancer susceptibility. We have discovered that there are mutations in the coding sequence of the BRCA2 locus in kindreds which are responsible for the chromosome 13-linked cancer susceptibility known as BRCA2. The present invention not only facilitates the early detection of certain cancers, so vital to patient survival, but also permits the detection of susceptible individuals before they develop cancer.

Population Resources

Large, well-documented Utah kindreds are especially important in providing good resources for human genetic studies. Each large kindred independently provides the power to detect whether a BRCA2 susceptibility allele is segregating in that family. Recombinants informative for localization and isolation of the BRCA2 locus could be obtained only from kindreds large enough to confirm the presence of a susceptibility allele. Large sibships are especially important for studying breast cancer, since penetrance of the BRCA2 susceptibility allele is reduced both by age and sex, making informative sibships difficult to find. Furthermore, large sibships are essential for constructing haplotypes of deceased individuals by inference from the haplotypes of their close relatives.

While other populations may also provide beneficial information, such studies generally require much greater effort, and the families are usually much smaller and thus less informative. Utah’s age-adjusted breast cancer incidence is 20% lower than the average U.S. rate. The lower incidence in Utah is probably due largely to an early age at first pregnancy, increasing the probability that cases found in Utah kindreds carry a genetic predisposition.

Genetic Mapping

Given a set of informative families, genetic markers are essential for linking a disease to a region of a chromosome. Such markers include restriction fragment length polymorphisms (RFLPs) (Botstein et al., 1980), markers with a variable number of tandem repeats (VNTRs) (Jeffreys et cl., 1985, Nakamura et al., 1987), and an abundant class of DNA polymorphisms based on short tandem repeats (STRs), especially repeats of CpA (Weber and May, 1989; Litt et al., 1989). To generate a genetic map, one selects potential genetic markers and tests them using DNA extracted from members of the kindreds being studied.

Genetic markers useful in searching for a genetic locus associated with a disease can be selected on an ad hoc basis, by densely covering a specific chromosome, or by detailed analysis of a specific region of a chromosome. A preferred method for selecting genetic markers linked with a disease involves evaluating the degree of informativeness of kindreds to determine the ideal distance between genetic markers of a given degree of polymorphism, then selecting markers from known genetic maps which are ideally spaced for maximal efficiency. Informativeness of kindreds is measured by the probability that the markers will be heterozygous in unrelated individuals. It is also most efficient to use STR markers which are detected by amplification of the target nucleic acid sequence using PCR; such markers are highly informative, easy to assay (Weber and May, 1989), and can be assayed simultaneously using multiplexing strategies (Skolnick and Wallace, 1988), greatly reducing the number of experiments required.

Once linkage has been established, one needs to find markers that flank the disease locus, i.e., one or more markers proximal to the disease locus, and one or more markers distal to the disease locus. Where possible, candidate markers can be selected from a known genetic map. Where none is known, new markers can be identified by the STR technique, as shown in the Examples.

Genetic mapping is usually an iterative process. In the present invention, it began by defining flanking genetic markers around the BRCA2 locus, then replacing these flanking markers with other markers that were successively closer to the BRCA2 locus. As an initial step, recombination events, defined by large extended kindreds, helped specifically to localize the BRCA2 locus as either distal or proximal to a specific genetic marker (Wooster el al., 1994).

The region surrounding BRCA2, until the disclosure of the present invention, was not well mapped and there were few markers. Therefore, short repetitive sequences were developed from cosmids, P1s, BACs and YACs, which physically map to the region and were analyzed in order to develop new genetic markers. Novel STRs were found which were both polymorphic and which mapped to the BRCA2 region.

Physical Mapping

Three distinct methods were employed to physically map the region. The first was the use of yeast artificial chromosomes (YACs) to clone the BRCA2 region. The second was the creation of a set of P1, BAC and cosmid clones which cover the region containing the BRCA2 locus.

Yeast Artificial Chromosomes (YACs). Once a sufficiently small region containing the BRCA2 locus was identified, physical isolation of the DNA in the region proceeded by identifying a set of overlapping YACs which covers the region. Useful YACs can be isolated from known libraries, such as the St. Louis and CEPH YAC libraries, which are widely distributed and contain approximately 50,000 YACs each. The YACs isolated were from these publicly accessible libraries and can be obtained from a number of sources including the Michigan Genome Center.

Clearly, others who had access to these YACs, without the disclosure of the present invention, would not have known the value of the specific YACs we selected since they would not have known which YACs were within, and which YACs outside of, the smallest region containing the BRCA2 locus.

P1 and BAC Clones. In the present invention, it is advantageous to proceed by obtaining P1 and BAC clones to cover this region. The smaller size of these inserts, compared to YAC inserts, makes them more useful as specific hybridization probes. Furthermore, having the cloned DNA in bacterial cells, rather than in yeast cells, greatly increases the ease with which the DNA of interest can be manipulated, and improves the signal-to-noise ratio of hybridization assays.

P1 and BAC clones are obtained by screening libraries constructed from the total human genome with specific sequence tagged sites (STSs) derived from the YACs, P1 s and BACs, isolated as described herein.

These P1 and BAC clones can be compared by interspersed repetitive sequence (IRS) PCR and/or restriction enzyme digests followed by gel electrophoresis and comparison of the resulting DNA fragments (“fingerprints”) (Maniatis el al., 1982). The clones can also be characterized by the presence of STSs. The fingerprints are used to define an overlapping contiguous set of clones which covers the region but is not excessively redundant, referred to herein as a “minimum tiling path”. Such a minimum tiling path forms the basis for subsequent experiments to identify cDNAs which may originate from the BRCA2 locus.

P1 clones (Sternberg, 1990; Sternberg et al., 1990; Pierce el al., 1992; Shizuya et al., 1992) were isolated by Genome Sciences using PCR primers provided by us for screening. BACs were provided by hybridization techniques in Dr. Mel Simon’s laboratory and by analysis of PCR pools in our laboratory. The strategy of using P1 and BAC clones also permitted the covering of the genomic region with an independent set of clones not derived from YACs. This guards against the possibility of deletions in YACs. These new sequences derived from the P1 and BAC clones provide the material for further screening for candidate genes, as described below.

Gene Isolation.

There are many techniques for testing genomic clones for the presence of sequences likely to be candidates for the coding sequence of a locus one is attempting to isolate, including but not limited to: (a) zoo blots, (b) identifying HTF islands, (c) exon trapping, (d) hybridizing cDNA to P1s, BAC or YACs and (e) screening cDNA libraries.

(a) Zoo blots. The first technique is to hybridize cosmids to Southern blots to identify DNA sequences which are evolutionarily conserved, and which therefore give positive hybridization signals with DNA from species of varying degrees of relationship to humans (such as monkey, cow, chicken, pig, mouse and rat). Southern blots containing such DNA from a variety of species are commercially available (Clonetech, Cat. 7753-1).

(b) Identifying HTF islands. The second technique involves finding regions rich in the nucleotides C and G, which often occur near or within coding sequences. Such sequences are called HTF (HpaI tiny fragment) or CpG islands, as restriction enzymes specific for sites which contain CpG dimers cut frequently in these regions (Lindsay et al., 1987).

(c) Exon trapping. The third technique is exon trapping, a method that identifies sequences in genomic DNA which contain splice junctions and therefore are likely to comprise coding sequences of genes. Exon amplification (Buckler et al., 1991) is used to select and amplify exons from DNA clones described above. Exon amplification is based on the selection of RNA sequences which are flanked by functional 5′ and/or 3′ splice sites. The products of the exon amplification are used to screen the breast cDNA libraries to identify a manageable number of candidate genes for further study. Exon trapping can also be performed on small segments of sequenced DNA using computer programs or by software trapping.

(d) Hybridizing cDNA to P1s. BACs or YACs. The fourth technique is a modification of the selective enrichment technique which utilizes hybridization of cDNA to cosmids, P1s, BACs or YACs and permits transcribed sequences to be identified in, and recovered from cloned genomic DNA (Kandpal et al., 1990). The selective enrichment technique, as modified for the present purpose, involves binding DNA from the region of BRCA2 present in a YAC to a column matrix and selecting cDNAs from the relevant libraries which hybridize with the bound DNA, followed by amplification and purification of the bound DNA, resulting in a great enrichment for cDNAs in the region represented by the cloned genomic DNA.

(e) Identification of cDNAs. The fifth technique is to identify cDNAs that correspond to the BRCA2 locus. Hybridization probes containing putative coding sequences, selected using any of the above techniques, are used to screen various libraries, including breast tissue cDNA libraries and any other necessary libraries.

Another variation on the theme of direct selection of cDNA can be used to find candidate genes for BRCA2 (Lovett et al., 1991; Futreal, 1993). This method uses cosmid, P1 or BAC DNA as the probe. The probe DNA is digested with a blunt cutting restriction enzyme such as HaeIII. Double stranded adapters are then ligated onto the DNA and serve as binding sites for primers in subsequent PCR amplification reactions using biotinylated primers. Target cDNA is generated from mRNA derived from tissue samples, e.g., breast tissue, by synthesis of either random primed or oligo(dT) primed first strand followed by second strand synthesis. The cDNA ends are rendered blunt and ligated onto double-stranded adapters. These adapters serve as amplification sites for PCR. The target and probe sequences are denatured and mixed with human C.sub.o t-1 DNA to block repetitive sequences. Solution hybridization is carried out to high C.sub.o t-1/2 values to ensure hybridization of rare target cDNA molecules. The annealed material is then captured on avidin beads, washed at high stringency and the retained cDNAs are eluted and amplified by PCR. The selected cDNA is subjected to further rounds of enrichment before cloning into a plasmid vector for analysis.

Testing the cDNA for Candidacy

Proof that the cDNA is the BRCA2 locus is obtained by finding sequences in DNA extracted from affected kindred members which create abnormal BRCA2 gene products or abnormal levels of BRCA2 gene product. Such BRCA2 susceptibility alleles will co-segregate with the disease in large kindreds. They will also be present at a much higher frequency in non-kindred individuals with breast cancer then in individuals in the general population. Finally, since tumors often mutate somatically at loci which are in other instances mutated in the germline, we expect to see normal germline BRCA2 alleles mutated into sequences which are identical or similar to BRCA2 susceptibility alleles in DNA extracted from tumor tissue. Whether one is comparing BRCA2 sequences from tumor tissue to BRCA2 alleles from the germline of the same individuals, or one is comparing germline BRCA2 alleles from cancer cases to those from unaffected individuals, the key is to find mutations which are serious enough to cause obvious disruption to the normal function of the gene product. These mutations can take a number of forms. The most severe forms would be frame shift mutations or large deletions which would cause the gene to code for an abnormal protein or one which would significantly alter protein expression. Less severe disruptive mutations would include small in-frame deletions and nonconservative base pair substitutions which would have a significant effect on the protein produced, such as changes to or from a cysteine residue, from a basic to an acidic amino acid or vice versa, from a hydrophobic to hydrophilic amino acid or vice versa, or other mutations which would affect secondary, tertiary or quaternary protein structure. Silent mutations or those resulting in conservative amino acid substitutions would not generally be expected to disrupt protein function.

According to the diagnostic and prognostic method of the present invention, alteration of the wild-type BRCA2 locus is detected. In addition, the method can be performed by detecting the wild-type BRCA2 locus and confirming the lack of a predisposition to cancer at the BRCA2 locus. “Alteration of a wild-type gene” encompasses all forms of mutations including deletions, insertions and point mutations in the coding and noncoding regions. Deletions may be of the entire gene or of only a portion of the gene. Point mutations may result in stop codons, frameshift mutations or amino acid substitutions. Somatic mutations are those which occur only in certain tissues, e.g., in the tumor tissue, and are not inherited in the germline. Germline mutations can be found in any of a body’s tissues and are inherited. If only a single allele is somatically mutated, an early neoplastic state is indicated. However, if both alleles are somatically mutated, then a late neoplastic state is indicated. The finding of BRCA2 mutations thus provides both diagnostic and prognostic information. A BRCA2 allele which is not deleted (e.g., found on the sister chromosome to a chromosome carrying a BRCA2 deletion) can be screened for other mutations, such as insertions, small deletions, and point mutations. It is believed that many mutations found in tumor tissues will be those leading to decreased expression of the BRCA2 gene product. However, mutations leading to non-functional gene products would also lead to a cancerous state. Point mutational events may occur in regulatory regions. Such as in the promoter of the gene, leading to loss or diminution of expression of the mRNA. Point mutations may also abolish proper RNA processing, leading to loss of expression of the BRCA2 gene product, or to a decrease in mRNA stability or translation efficiency.

Useful diagnostic techniques include, but are not limited to fluorescent in situ hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single stranded conformation analysis (SSCA), RNase protection assay, allele-specific oligonucleotide (ASO), dot blot analysis and PCR-SSCP, as discussed in detail further below.

Predisposition to cancers, such as breast cancer, and the other cancers identified herein, can be ascertained by testing any tissue of a human for mutations of the BRCA2 gene. For example, a person who has inherited a germline BRCA2 mutation would be prone to develop cancers. This can be determined by testing DNA from any tissue of the person’s body. Most simply, blood can be drawn and DNA extracted from the cells of the blood. In addition, prenatal diagnosis can be accomplished by testing fetal cells, placental cells or amniotic cells for mutations of the BRCA2 gene. Alteration of a wild-type BRCA2 allele, whether, for example, by point mutation or deletion, can be detected by any of the means discussed herein.

There are several methods that can be used to detect DNA sequence variation. Direct DNA sequencing, either manual sequencing or automated fluorescent sequencing can detect sequence variation. For a gene as large as BRCA2, manual sequencing is very labor-intensive, but under optimal conditions, mutations in the coding sequence of a gene are rarely missed. Another approach is the single-stranded conformation polymorphism assay (SSCA) (Orita el al., 1989). This method does not detect all sequence changes, especially if the DNA fragment size is greater than 200 bp, but can be optimized to detect most DNA sequence variation. The reduced detection sensitivity is a disadvantage but the increased throughput possible with SSCA makes it an attractive, viable alternative to direct sequencing for mutation detection on a research basis. The fragments which have shifted mobility on SSCA gels are then sequenced to determine the exact nature of the DNA sequence variation. Other approaches based on the detection of mismatches between the two complementary DNA strands include clamped denaturing gel electrophoresis (CDGE) (Sheffield et al., 1991), heteroduplex analysis (HA) (White et al., 1992) and chemical mismatch cleavage (CMC) (Grompe el al., 1989). None of the methods described above will detect large deletions, duplications or insertions, nor will they detect a regulatory mutation which affects transcription or translation of the protein. Other methods which might detect these classes of mutations such as a protein truncation assay or the asymmetric assay, detect only specific types of mutations and would not detect missense mutations. A review of currently available methods of detecting DNA sequence variation can be found in a recent review by Grompe (1993). Once a mutation is known, an allele specific detection approach such as allele specific oligonucleotide (ASO) hybridization can be utilized to rapidly screen large numbers of other samples for that same mutation.

In order to detect the alteration of the wild-type BRCA2 gene in a tissue, it is helpful to isolate the tissue free from surrounding normal tissues. Means for enriching tissue preparation for tumor cells are known in the art. For example, the tissue may be isolated from paraffin or cryostat sections. Cancer cells may also be separated from normal cells by flow cytometry. These techniques, as well as other techniques for separating tumor cells from normal cells, are well known in the art. If the tumor tissue is highly contaminated with normal cells, detection of mutations is more difficult.

A rapid preliminary analysis to detect polymorphisms in DNA sequences can be performed by looking at a series of Southern blots of DNA cut with one or more restriction enzymes, preferably with a large number of restriction enzymes. Each blot contains a series of normal individuals and a series of cancer cases, tumors, or both. Southern blots displaying hybridizing fragments (differing in length from control DNA when probed with sequences near or including the BRCA2 locus) indicate a possible mutation. If restriction enzymes which produce very large restriction fragments are used, then pulsed field gel electrophoresis (PFGE) is employed.

Detection of point mutations may be accomplished by molecular cloning of the BRCA2 allele(s) and sequencing the allele(s) using techniques well known in the art. Alternatively, the gene sequences can be amplified directly from a genomic DNA preparation from the tumor tissue, using known techniques. The DNA sequence of the amplified sequences can then be determined.

There are six well known methods for a more complete, yet still indirect, test for confirming the presence of a susceptibility allele: I) single stranded conformation analysis (SSCA) (Orita et al., 1989); 2) denaturing gradient gel electrophoresis (DGGE) (Wartell et al., 1990; Sheffield et al., 1989); 3) RNase protection assays (Finkelstein et al., 1990; Kinszler et al., 1991); 4) allele-specific oligonucleotides (ASOs) (Conner et al., 1983); 5) the use of proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich, 1991); and 6) allele-specific PCR (Rano & Kidd, 1989). For allele-specific PCR, primers are used which hybridize at their 3′ ends to a particular BRCA2 mutation. If the particular BRCA2 mutation is not present, an amplification product is not observed. Amplification Refractory Mutation System (ARMS) can also be used, as disclosed in European Patent Application Publication No. 0332435 and in Newton et al., 1989.

Insertions and deletions of genes can also be detected by cloning, sequencing and amplification. In addition, restriction fragment length polymorphism (RFLP) probes for the gene or surrounding marker genes can be used to score alteration of an allele or an insertion in a polymorphic fragment. Such a method is particularly useful for screening relatives of an affected individual for the presence of the BRCA2 mutation found in that individual. Other techniques for detecting insertions and deletions as known in the art can be used.

In the first three methods (SSCA, DGGE and RNase protection assay), a new electrophoretic band appears. SSCA detects a band which migrates differentially because the sequence change causes a difference in single-strand, intramolecular base pairing. RNase protection involves cleavage of the mutant polynucleotide into two or more smaller fragments. DGGE detects differences in migration rates of mutant sequences compared to wild-type sequences, using a denaturing gradient gel. In an allele-specific oligonucleotide assay, an oligonucleotide is designed which detects a specific sequence, and the assay is performed by detecting the presence or absence of a hybridization signal. In the mutS assay, the protein binds only to sequences that contain a nucleotide mismatch in a heteroduplex between mutant and wild-type sequences.

Mismatches, according to the present invention, are hybridized nucleic acid duplexes in which the two strands are not 100% complementary. Lack of total homology may be due to deletions insertions, inversions or substitutions. Mismatch detection can be used to detect point mutations in the gene or in its mRNA product. While these techniques are less sensitive than sequencing, they are simpler to perform on a large number of tumor samples. An example of a mismatch cleavage technique is the RNase protection method. In the practice of the present invention, the method involves the use of a labeled riboprobe which is complementary to the human wild-type BRCA2 gene coding sequence. The riboprobe and either mRNA or DNA isolated from the tumor tissue are annealed (hybridized) together and subsequently digested with the enzyme RNase A which is able to detect some mismatches in a duplex RNA structure. If a mismatch is detected by RNase A, it cleaves at the site of the mismatch. Thus, when the annealed RNA preparation is separated on an electrophoretic gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product will be seen which is smaller than the full length duplex RNA for the riboprobe and the mRNA or DNA. The riboprobe need not be the full length of the BRCA2 mRNA or gene but can be a segment of either. If the riboprobe comprises only a segment of the BRCA2 mRNA or gene it will be desirable to use a number of these probes to screen the whole mRNA sequence for mismatches.

In similar fashion, DNA probes can be used to detect mismatches, through enzymatic or chemical cleavage. See, e.g., Cotton et al., 1988; Shenk et al., 1975; Novack et al., 1986. Alternatively, mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes. See, e.g., Cariello, 1988. With either riboprobes or DNA probes, the cellular mRNA or DNA which might contain a mutation can be amplified using PCR (see below) before hybridization. Changes in DNA of the BRCA2 gene can also be detected using Southern hybridization, especially if the changes are gross rearrangements, such as deletions and insertions.

DNA sequences of the BRCA2 gene which have been amplified by use of PCR may also be screened using allele-specific probes. These probes are nucleic acid oligomers, each of which contains a region of the BRCA2 gene sequence harboring a known mutation. For example, one oligomer may be about 30 nucleotides in length, corresponding to a portion of the BRCA2 gene sequence. By use of a battery of such allele-specific probes, PCR amplification products can be screened to identify the presence of a previously identified mutation in the BRCA2 gene. Hybridization of allele-specific probes with amplified BRCA2 sequences can be performed, for example, on a nylon filter. Hybridization to a particular probe under stringent hybridization conditions indicates the presence of the same mutation in the tumor tissue as in the allele-specific probe.

The most definitive test for mutations in a candidate locus is to directly compare genomic BRCA2 sequences from cancer patients with those from a control population. Alternatively, one could sequence messenger RNA after amplification, e.g., by PCR, thereby eliminating the necessity of determining the exon structure of the candidate gene.

Mutations from cancer patients falling outside the coding region of BRCA2 can be detected by examining the non-coding regions, such as introns and regulatory sequences near or within the BRCA2 gene. An early indication that mutations in noncoding regions are important may come from Northern blot experiments that reveal messenger RNA molecules of abnormal size or abundance in cancer patients as compared to control individuals.

Alteration of BRCA2 mRNA expression can be detected by any techniques known in the art.

These include Northern blot analysis, PCR amplification and RNase protection. Diminished mRNA expression indicates an alteration of the wild-type BRCA2 gene. Alteration of wild-type BRCA2 genes can also be detected by screening for alteration of wild-type BRCA2 protein. For example, monoclonal antibodies immunoreactive with BRCA2 can be used to screen a tissue. Lack of cognate antigen would indicate a BRCA2 mutation. Antibodies specific for products of mutant alleles could also be used to detect mutant BRCA2 gene product. Such immunological assays can be done in any convenient formats known in the art. These include Western blots, immunohistochemical assays and ELISA assays. Any means for detecting an altered BRCA2 protein can be used to detect alteration of wild-type BRCA2 genes. Functional assays, such as protein binding determinations, can be used. In addition, assays can be used which detect BRCA2 biochemical function. Finding a mutant BRCA2 gene product indicates alteration of a wild-type BRCA2 gene.

Mutant BRCA2 genes or gene products can also be detected in other human body samples, such as serum, stool, urine and sputum. The same techniques discussed above for detection of mutant BRCA2 genes or gene products in tissues can be applied to other body samples. Cancer cells are sloughed off from tumors and appear in such body samples. In addition, the BRCA2 gene product itself may be secreted into the extracellular space and found in these body samples even in the absence of cancer cells. By screening such body samples, a simple early diagnosis can be achieved for many types of cancers. In addition, the progress of chemotherapy or radiotherapy can be monitored more easily by testing such body samples for mutant BRCA2 genes or gene products.

The methods of diagnosis of the present invention are applicable to any tumor in which BRCA2 has a role in tumorigenesis. The diagnostic method of the present invention is useful for clinicians, so they can decide upon an appropriate course of treatment.

The primer pairs of the present invention are useful for determination of the nucleotide sequence of a particular BRCA2 allele using PCR. The pairs of single-stranded DNA primers can be annealed to sequences within or surrounding the BRCA2 gene on chromosome 13 in order to prime amplifying DNA synthesis of the BRCA2 gene itself. A complete set of these primers allows synthesis of all of the nucleotides of the BRCA2 gene coding sequences, i.e., the exons. The set of primers preferably allows synthesis of both intron and exon sequences. Allele-specific primers can also be used. Such primers anneal only to particular BRCA2 mutant alleles, and thus will only amplify a product in the presence of the mutant allele as a template.

In order to facilitate subsequent cloning of amplified sequences, primers may have restriction enzyme site sequences appended to their 5′ ends. Thus, all nucleotides of the primers are derived from BRCA2 sequences or sequences adjacent to BRCA2, except for the few nucleotides necessary to form a restriction enzyme site. Such enzymes and sites are well known in the art. The primers themselves can be synthesized using techniques which are well known in the art. Generally, the primers can be made using oligonucleotide synthesizing machines which are commercially available. Given the sequence of the BRCA2 open reading frame shown in SEQ ID NO:1 and in FIG. 3, design of particular primers, in addition to those disclosed below, is well within the skill of the art.

The nucleic acid probes provided by the present invention are useful for a number of purposes. They can be used in Southern hybridization to genomic DNA and in the RNase protection method for detecting point mutations already discussed above. The probes can be used to detect PCR amplification products. They may also be used to detect mismatches with the BRCA2 gene or mRNA using other techniques.

It has been discovered that individuals with the wild-type BRCA2 gene do not have cancer which results from the BRCA2 allele. However, mutations which interfere with the function of the BRCA2 protein are involved in the pathogenesis of cancer. Thus, the presence of an altered (or a mutant) BRCA2 gene which produces a protein having a loss of function, or altered function, directly correlates to an increased risk of cancer. In order to detect a BRCA2 gene mutation, a biological sample is prepared and analyzed for a difference between the sequence of the BRCA2 allele being analyzed and the sequence of the wild-type BRCA2 allele. Mutant BRCA2 alleles can be initially identified by any of the techniques described above. The mutant alleles are then sequenced to identify the specific mutation of the particular mutant allele. Alternatively, mutant BRCA2 alleles can be initially identified by identifying mutant (altered) BRCA2 proteins, using conventional techniques. The mutant alleles are then sequenced to identify the specific mutation for each allele. The mutations, especially those which lead to an altered function of the BRCA2 protein, are then used for the diagnostic and prognostic methods of the present invention.

Definitions

The present invention employs the following definitions:

“Amplification of Polynucleotides” utilizes methods such as the polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR) and amplification methods based on the use of Q-beta replicase. These methods are well known and widely practiced in the art. See, e.g. U.S. Pat. Nos. 4.683,195 and 4.683.202 and Innis et al., 1990 (for PCR); and Wu et al., 1989a (for LCR). Reagents and hardware for conducting PCR are commercially available. Primers useful to amplify sequences from the BRCA2 region are preferably complementary to, and hybridize specifically to sequences in the BRCA2 region or in regions that flank a target region therein. BRCA2 sequences generated by amplification may be sequenced directly. Alternatively, but less desirably, the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments has been described by Scharf, 1986.

“Analyte polynucleotide” and “analyte strand” refer to a single- or double-stranded polynucleotide which is suspected of containing a target sequence, and which may be present in a variety of types of samples, including biological samples.

“Antibodies.” The present invention also provides polyclonal and/or monoclonal antibodies and fragments thereof, and immunologic binding equivalents thereof, which are capable of specifically binding to the BRCA2 polypeptides and fragments thereof or to polynucleotide sequences from the BRCA2 region, particularly from the BRCA2 locus or a portion thereof. The term “antibody” is used both to refer to a homogeneous molecular entity, or a mixture such as a serum product made up of a plurality of different molecular entities. Polypeptides may be prepared synthetically in a peptide synthesizer and coupled to a carrier molecule (e.g., keyhole limpet hemocyanin) and injected over several months into rabbits. Rabbit sera is tested for immunoreactivity to the BRCA2 polypeptide or fragment. Monoclonal antibodies may be made by injecting mice with the protein polypeptides, fusion proteins or fragments thereof. Monoclonal antibodies will be screened by ELISA and tested for specific immunoreactivity with BRCA2 polypeptide or fragments thereof. See, Harlow & Lane, 1988. These antibodies will be useful in assays as well as pharmaceuticals.

Once a sufficient quantity of desired polypeptide has been obtained, it may be used for various purposes. A typical use is the production of antibodies specific for binding. These antibodies may be either polyclonal or monoclonal, and may be produced by in vitro or in vivo techniques well known in the art. For production of polyclonal antibodies, an appropriate target immune system, typically mouse or rabbit, is selected. Substantially purified antigen is presented to the immune system in a fashion determined by methods appropriate for the animal and by other parameters well known to immunologists. Typical sites for injection are in footpads, intramuscularly, intraperitoneally, or intradermally. Of course, other species may be substituted for mouse or rabbit. Polyclonal antibodies are then purified using techniques known in the art, adjusted for the desired specificity.

An immunological response is usually assayed with an immunoassay. Normally, such immunoassays involve some purification of a source of antigen, for example, that produced by the same cells and in the same fashion as the antigen. A variety of immunoassay methods are well known in the art. See, e.g., Harlow & Lane, 1988, or Goding, 1986.

Monoclonal antibodies with affinities of 10.sup.-8 M.sup.-1 or preferably 10.sup.-9 to 10.sup.-10 M.sup.-1 or stronger will typically be made by standard procedures as described, e.g., in Harlow & Lane, 1988 or Goding, 1986. Briefly, appropriate animals will be selected and the desired immunization protocol followed. After the appropriate period of time, the spleens of such animals are excised and individual spleen cells fused, typically, to immortalized myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone tested for their production of an appropriate antibody specific for the desired region of the antigen.

Other suitable techniques involve in vitro exposure of lymphocytes to the antigenic polypeptides, or alternatively, to selection of libraries of antibodies in phage or similar vectors. See Huse et al. 1989. The polypeptides and antibodies of the present invention may be used with or without modification. Frequently, polypeptides and antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241. Also, recombinant immunoglobulins may be produced (see U.S. Pat. No. 4,816,567).

“Binding partner” refers to a molecule capable of binding a ligand molecule with high specificity, as for example, an antigen and an antigen-specific antibody or an enzyme and its inhibitor. In general, the specific binding partners must bind with sufficient affinity to immobilize the analyte copy/complementary strand duplex (in the case of polynucleotide hybridization) under the isolation conditions. Specific binding partners are known in the art and include, for example, biotin and avidin or streptavidin, IgG and protein A, the numerous, known receptor-ligand couples, and complementary polynucleotide strands. In the case of complementary polynucleotide binding partners, the partners are normally at least about 15 bases in length, and may be at least 40 bases in length. The polynucleotides may be composed of DNA, RNA, or synthetic nucleotide analogs.

A “biological sample” refers to a sample of tissue or fluid suspected of containing an analyte polynucleotide or polypeptide from an individual including, but not limited to, e.g., plasma, serum, spinal fluid., lymph fluid, the external sections of the skin, respiratory, intestinal, and genito-urinary tracts, tears, saliva, blood cells, tumors, organs, tissue and samples of in vitro cell culture constituents.

As used herein, the terms “diagnosing” or “prognosing,” as used in the context of neoplasia, are used to indicate 1) the classification of lesions as neoplasia, 2) the determination of the severity of the neoplasia, or 3) the monitoring of the disease progression, prior to, during and after treatment.

“Encode”. A polynucleotide is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof. The anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

“Isolated” or “substantially pure”. An “isolated” or “substantially pure” nucleic acid (e.g., an RNA, DNA or a mixed polymer) is one which is substantially separated from other cellular components which naturally accompany a native human sequence or protein, e.g., ribosomes, polymerases, many other human genome sequences and proteins. The term embraces a nucleic acid sequence or protein which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.

“BRCA2 Allele” refers to normal alleles of the BRCA2 locus as well as alleles carrying variations that predispose individuals to develop cancer of many sites including, for example, breast, ovarian and stomach cancer. Such predisposing alleles are also called “BRCA2 susceptibility alleles”.

“BRCA2 Locus,” “BRCA2 Gene,” “BRCA2 Nucleic Acids” or “BRCA2 Polynucleotide” each refer to polynucleotides, all of which are in the BRCA2 region, that are likely to be expressed in normal tissue, certain alleles of which predispose an individual to develop breast, ovarian and stomach cancers. Mutations at the BRCA2 locus may be involved in the initiation and/or progression of other types of tumors. The locus is indicated in part by mutations that predispose individuals to develop cancer. These mutations fall within the BRCA2 region described infra. The BRCA2 locus is intended to include coding sequences, intervening sequences and regulatory elements controlling transcription and/or translation. The BRCA2 locus is intended to include all allelic variations of the DNA sequence.

These terms, when applied to a nucleic acid, refer to a nucleic acid which encodes a BRCA2 polypeptide, fragment, homolog or variant, including, e.g., protein fusions or deletions. The nucleic acids of the present invention will possess a sequence which is either derived from, or substantially similar to a natural BRCA2-encoding gene or one having substantial homology with a natural BRCA2-encoding gene or a portion thereof. The coding sequence for a BRCA2 polypeptide is shown in SEQ ID NO:1 and FIG. 3, with the amino acid sequence shown in SEQ ID NO:2.

The polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide link-ages substitute for phosphate linkages in the backbone of the molecule.

The present invention provides recombinant nucleic acids comprising all or part of the BRCA2 region. The recombinant construct may be capable of replicating autonomously in a host cell. Alternatively, the recombinant construct may become integrated into the chromosomal DNA of the host cell. Such a recombinant polynucleotide comprises a polynucleotide of genomic, cDNA, semi-synthetic, or synthetic origin which, by virtue of its origin or manipulation, 1) is not associated with all or a portion of a polynucleotide with which it is associated in nature; 2) is linked to a polynucleotide other than that to which it is linked in nature; or 3) does not occur in nature.

Therefore, recombinant nucleic acids comprising sequences otherwise not naturally occurring are provided by this invention. Although the wild-type sequence may be employed, it will often be altered, e.g., by deletion, substitution or insertion.

cDNA or genomic libraries of various types may be screened as natural sources of the nucleic acids of the present invention, or such nucleic acids may be provided by amplification of sequences resident in genomic DNA or other natural sources, e.g., by PCR. The choice of cDNA libraries normally corresponds to a tissue source which is abundant in MRNA for the desired proteins. Phage libraries are normally preferred, but other types of libraries may be used. Clones of a library are spread onto plates, transferred to a substrate for screening, denatured and probed for the presence of desired sequences.

The DNA sequences used in this invention will usually comprise at least about five codons (15 nucleotides), more usually at least about 7-15 codons, and most preferably, at least about 35 codons. One or more introns may also be present. This number of nucleotides is usually about the minimal length required for a successful probe that would hybridize specifically with a BRCA2-encoding sequence.

Techniques for nucleic acid manipulation are described generally, for example, in Sambrook el al., 1989 or Ausubel el al., 1992. Reagents useful in applying such techniques, such as restriction enzymes and the like, are widely known in the art and commercially available from such vendors as New England BioLabs, Boehringer Mannheim, Amersham, Promega Biotec, U. S. Biochemicals, New England Nuclear, and a number of other sources. The recombinant nucleic acid sequences used to produce fusion proteins of the present invention may be derived from natural or synthetic sequences. Many natural gene sequences are obtainable from various cDNA or from genomic libraries using, appropriate probes. See, GenBank, National Institutes of Health.

“BRCA2 Region” refers to a portion of human chromosome 13 bounded by the markers tdj3820 and YS-G-B10T. This region contains the BRCA2 locus, including the BRCA2 gene.

As used herein, the terms “BRCA2 locus,” “BRCA2 allele” and “BRCA2 region” all refer to the double-stranded DNA comprising the locus, allele, or region, as well as either of the single-stranded DNAs comprising the locus, allele or region.

As used herein, a “portion” of the BRCA2 locus or region or allele is defined as having a minimal size of at least about eight nucleotides, or preferably about 15 nucleotides, or more preferably at least about 25 nucleotides, and may have a minimal size of at least about 40 nucleotides.

“BRCA2 protein” or “BRCA2 polypeptide” refer to a protein or polypeptide encoded by the BRCA2 locus, variants or fragments thereof. The term “polypeptide” refers to a polymer of amino acids and its equivalent and does not refer to a specific length of the product; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide. This term also does not refer to, or exclude modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations, and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non-naturally occurring. Ordinarily, such polypeptides will be at least about 50% homologous to the native BRCA2 sequence, preferably in excess of about 90%, and more preferably at least about 95% homologous. Also included are proteins encoded by DNA which hybridize under high or low stringency conditions, to BRCA2-encoding nucleic acids and closely related polypeptides or proteins retrieved by antisera to the BRCA2 protein(s).

The length of polypeptide sequences compared for homology will generally be at least about 16 amino acids, usually at least about 20 residues, more usually at least about 24 residues, typically at least about 28 residues, and preferably more than about 35 residues. “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression.

“Probes”. Polynucleotide polymorphisms associated with BRCA2 alleles which predispose to certain cancers or are associated with most cancers are detected by hybridization with a polynucleotide probe which forms a stable hybrid with that of the target sequence, under stringent to moderately stringent hybridization and wash conditions. If it is expected that the probes will be perfectly complementary to the target sequence, stringent conditions will be used. Hybridization stringency may be lessened if some mismatching is expected, for example, if variants are expected with the result that the probe will not be completely complementary. Conditions are chosen which rule out nonspecific/adventitious bindings, that is, which minimize noise. Since such indications identify neutral DNA polymorphisms as well as mutations, these indications need further analysis to demonstrate detection of a BRCA2 susceptibility allele.

Probes for BRCA2 alleles may be derived from the sequences of the BRCA2 region or its cDNAs. The probes may be of any suitable length, which span all or a portion of the BRCA2 region, and which allow specific hybridization to the BRCA2 region. If the target sequence contains a sequence identical to that of the probe, the probes may be short, e.g., in the range of about 8-30 base pairs, since the hybrid will be relatively stable under even stringent conditions. If some degree of mismatch is expected with the probe, i.e., if it is suspected that the probe will hybridize to a variant region, a longer probe may be employed which hybridizes to the target sequence with the requisite specificity.

The probes will include an isolated polynucleotide attached to a label or reporter molecule and may be used to isolate other polynucleotide sequences, having sequence similarity by standard methods. For techniques for preparing and labeling probes see, e.g., Sambrook et al., 1989 or Ausubel et al., 1992. Other similar polynucleotides may be selected by using homologous polynucleotides. Alternatively, polynucleotides encoding these or similar polypeptides may be synthesized or selected by use of the redundancy in the genetic code. Various codon substitutions may be introduced, e.g., by silent changes (thereby producing various restriction sites) or to optimize expression for a particular system. Mutations may be introduced to modify the properties of the polypeptide, perhaps to change ligand-binding affinities, interchain affinities, or the polypeptide degradation or turnover rate.

Probes comprising synthetic oligonucleotides or other polynucleotides of the present invention may be derived from naturally occurring or recombinant single- or double-stranded polynucleotides, or be chemically synthesized. Probes may also be labeled by nick translation, Klenow fill-in reaction, or other methods known in the art.

Portions of the polynucleotide sequence having at least about eight nucleotides, usually at least about 15 nucleotides, and fewer than about 6 kb, usually fewer than about 1.0 kb, from a polynucleotide sequence encoding BRCA2 are preferred as probes. The probes may also be used to determine whether mRNA encoding BRCA2 is present in a cell or tissue.

“Protein modifications or fragments” are provided by the present invention for BRCA2 polypeptides or fragments thereof which are substantially homologous to primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate unusual amino acids. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as .sup.32 p, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods of labeling polypeptides are well known in the art. See, e.g., Sambrook et al., 1989 or Ausubel et al., 1992.

Besides substantially full-length polypeptides, the present invention provides for biologically active fragments of the polypeptides. Significant biological activities include ligand-binding, immunological activity and other biological activities characteristic of BRCA2 polypeptides. Immunological activities include both immunogenic function in a target immune system, as well as sharing of immunological epitopes for binding, serving as either a competitor or substitute antigen for an epitope of the BRCA2 protein. As used herein, “epitope” refers to an antigenic determinant of a polypeptide. An epitope could comprise three amino acids in a spatial conformation which is unique to the epitope. Generally, an epitope consists of at least five such amino acids, and more usually consists of at least 8-10 such amino acids. Methods of determining the spatial conformation of such amino acids are known in the art.

For immunological purposes, tandem-repeat polypeptide segments may be used as immunogens, thereby producing highly antigenic proteins. Alternatively, such polypeptides will serve as highly efficient competitors for specific binding. Production of antibodies specific for BRCA2 polypeptides or fragments thereof is described below.

The present invention also provides for fusion polypeptides, comprising BRCA2 polypeptides and fragments. Homologous polypeptides may be fusions between two or more BRCA2 polypeptide sequences or between the sequences of BRCA2 and a related protein. Likewise, heterologous fusions may be constructed which would exhibit a combination of properties or activities of the derivative proteins. For example, ligand-binding or other domains may be “swapped” between different new fusion polypeptides or fragments. Such homologous or heterologous fusion polypeptides may display, for example, altered strength or specificity of binding. Fusion partners include immunoglobulins, bacterial .beta.-galactosidase, trpE, protein A, .beta.-lactamase, alpha amylase, alcohol dehydrogenase and yeast alpha mating factor. See, e.g., Godowski et al., 1988.

Fusion proteins will typically be made by either recombinant nucleic acid methods, as described below, or may be chemically synthesized. Techniques for the synthesis of polypeptides are described, for example, in Merrifield, 1963.

“Protein purification” refers to various methods for the isolation of the BRCA2 polypeptides from other biological material, such as from cells transformed with recombinant nucleic acids encoding BRCA2, and are well known in the art. For example, such polypeptides may be purified by immunoaffinity chromatography employing, e.g., the antibodies provided by the present invention. Various methods of protein purification are well known in the art, and include those described in Deutscher, 1990 and Scopes, 1982.

The terms “isolated”, “substantially pure”, and “substantially homogeneous” are used interchangeably to describe a protein or polypeptide which has been separated from components which accompany it in its natural state. A monomeric protein is substantially pure when at least about 60 to 75% of a sample exhibits a single polypeptide sequence. A substantially pure protein will typically comprise about 60 to 90% w/w of a protein sample, more usually about 95%, and preferably will be over about 99% pure. Protein purity or homogeneity may be indicated by a number of means well known in the art, such as polyacrylamide gel electrophoresis of a protein sample, followed by visualizing a single polypeptide band upon staining the gel. For certain purposes, higher resolution may be provided by using HPLC or other means well known in the art which are utilized for purification.

A BRCA2 protein is substantially free of naturally associated components when it is separated from the native contaminants which accompany it in its natural state. Thus, a polypeptide which is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components. A protein may also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art.

A polypeptide produced as an expression product of an isolated and manipulated genetic sequence is an “isolated polypeptide,” as used herein, even if expressed in a homologous cell type.

Synthetically made forms or molecules expressed by heterologous cells are inherently isolated molecules. “Recombinant nucleic acid” is a nucleic acid which is not naturally occurring, or which is made by the artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions.

“Regulatory sequences” refers to those sequences normally within 100 kb of the coding region of a locus, but they may also be more distant from the coding region, which affect the expression of the gene (including transcription of the gene, and translation, splicing, stability or the like of the messenger RNA).

“Substantial homology or similarity”. A nucleic acid or fragment thereof is “substantially homologous” (“or substantially similar”) to another if, when optimally aligned (with appropriate nucleotide insertions or deletions) with the other nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 60% of the nucleotide bases, usually at least about 70%, more usually at least about 80%, preferably at least about 90%, and more preferably at least about 95-98% of the nucleotide bases.

Alternatively, substantial homology or (similarity) exists when a nucleic acid or fragment thereof will hybridize to another nucleic acid (or a complementary strand thereof) under selective hybridization conditions, to a strand, or to its complement. Selectivity of hybridization exists when hybridization which is substantially more selective than total lack of specificity occurs. Typically, selective hybridization will occur when there is at least about 55% homology over a stretch of at least about 14 nucleotides, preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90%. See, Kanehisa, 1984. The length of homology comparison, as described, may be over longer stretches, and in certain embodiments will often be over a stretch of at least about nine nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36 or more nucleotides.

Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art. Stringent temperature conditions will generally include temperatures in excess of 30.degree. C., typically in excess of 37.degree. C., and preferably in excess of 45.degree. C. Stringent salt conditions will ordinarily be less than 1000 mM, typically less than 500 mM, and preferably less than 200 mM. However, the combination of parameters is much more important than the measure of any single parameter. See, e.g., Wetmur & Davidson, 1968.

Probe sequences may also hybridize specifically to duplex DNA under certain conditions to form triplex or other higher order DNA complexes. The preparation of such probes and suitable hybridization conditions are well known in the art.

The terms “substantial homology” or “substantial identity”, when referring to polypeptides, indicate that the polypeptide or protein in question exhibits at least about 30% identity with an entire naturally-occurring protein or a portion thereof, usually at least about 70% identity, and preferably at least about 95% identity.

“Substantially similar function” refers to the function of a modified nucleic acid or a modified protein, with reference to the wild-type BRCA2 nucleic acid or wild-type BRCA2 polypeptide. The modified polypeptide will be substantially homologous to the wild-type BRCA2 polypeptide and will have substantially the same function. The modified polypeptide may have an altered amino acid sequence and/or may contain modified amino acids. In addition to the similarity of function, the modified polypeptide may have other useful properties, such as a longer half-life. The similarity of function (activity) of the modified polypeptide may be substantially the same as the activity of the wild-type BRCA2 polypeptide. Alternatively, the similarity of function (activity) of the modified polypeptide may be higher than the activity of the wild-type BRCA2 polypeptide. The modified polypeptide is synthesized using conventional techniques, or is encoded by a modified nucleic acid and produced using conventional techniques. The modified nucleic acid is prepared by conventional techniques. A nucleic acid with a function substantially similar to the wild-type BRCA2 gene function produces the modified protein described above.

Homology, for polypeptides, is typically measured using(sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using measure of homology assigned to various substitutions, deletions and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

A polypeptide “fragment,” “portion” or “segment” is a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about 20 to 30 or more contiguous amino acids. The polypeptides of the present invention, if soluble, may be coupled to a solid-phase support, e.g., nitrocellulose, nylon, column packing materials (e.g., Sepharose beads), magnetic beads, glass wool, plastic, metal, polymer gels, cells, or other substrates. Such supports may take the form, for example, of beads, wells, dipsticks, or membranes.

“Target region” refers to a region of the nucleic acid which is amplified and/or detected. The term “target sequence” refers to a sequence with which a probe or primer will form a stable hybrid under desired conditions.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA, genetics, and immunology. See, e.g., Maniatis et al., 1982; Sambrook et al., 1989; Ausubel et al., 1992; Glover, 1985; Anand, 1992; Guthrie & Fink, 1991. A general discussion of techniques and materials for human gene mapping, including mapping of human chromosome 13, is provided, e.g., in White and Lalouel, 1988.

Preparation of recombinant or chemically synthesized nucleic acids; vectors, transformation, host cells

Large amounts of the polynucleotides of the present invention may be produced by replication in a suitable host cell. Natural or synthetic polynucleotide fragments coding for a desired fragment will be incorporated into recombinant polynucleotide constructs, usually DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell. Usually the polynucleotide constructs will be suitable for replication in a unicellular host, such as yeast or bacteria, but may also be intended for introduction to (with and without integration within the genome) cultured mammalian or plant or other eukaryotic cell lines. The purification of nucleic acids produced by the methods of the present invention is described, e.g., in Sambrook et al., 1989 or Ausubel et al., 1992.

The polynucleotides of the present invention may also be produced by chemical synthesis, e.g., by the phosphoramidite method described by Beaucage & Carruthers, 1981 or the triester method according to Matteucci and Caruthers, 1981, and may be performed on commercial, automated oligonucleotide synthesizers. A double-stranded fragment may be obtained from the single-stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strands together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.

Polynucleotide constructs prepared for introduction into a prokaryotic or eukaryotic host may comprise a replication system recognized by the host, including the intended polynucleotide fragment encoding the desired polypeptide, and will preferably also include transcription and translational initiation regulatory sequences operably linked to the polypeptide encoding segment. Expression vectors may include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences. Secretion signals may also be included where appropriate, whether from a native BRCA2 protein or from other receptors or from secreted polypeptides of the same or related species, which allow the protein to cross and/or lodge in cell membranes, and thus attain its functional topology, or be secreted from the cell. Such vectors may be prepared by means of standard recombinant techniques well known in the art and discussed, for example, in Sambrook el al, 1989 or Ausubel et al. 1992.

An appropriate promoter and other necessary vector sequences will be selected so as to be functional in the host, and may include, when appropriate, those naturally associated with BRCA2 genes. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al., 1989 or Ausubel et al., 1992; see also, e.g., Metzger et al., 1988. Many useful vectors are known in the art and may be obtained from such vendors as Stratagene, New England BioLabs, Promega Biotech, and others. Promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters may be used in prokaryotic hosts. Useful yeast promoters include promoter regions for metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes such as enolase or glyceraldehyde-3-phosphate dehydrogenase, enzymes responsible for maltose and galactose utilization, and others. Vectors and promoters suitable for use in yeast expression are further described in Hitzeman et al., EP 73,675A. Appropriate non-native mammalian promoters might include the early and late promoters from SV40 (Fiers et al, 1978) or promoters derived from murine Moloney leukemia virus, mouse tumor virus, avian sarcoma viruses, adenovirus II, bovine papilloma virus or polyoma. In addition, the construct may be joined to an amplifiable gene (e.g., DHFR) so that multiple copies of the gene may be made. For appropriate enhancer and other expression control sequences, see also Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1983).

While such expression vectors may replicate autonomously, they may also replicate by being inserted into the genome of the host cell, by methods well known in the art.

Expression and cloning vectors will likely contain a selectable marker, a gene encoding a protein necessary for survival or growth of a host cell transformed with the vector. The presence of this gene ensures growth of only those host cells which express the inserts. Typical selection genes encode proteins that a) confer resistance to antibiotics or other toxic substances, e.g. ampicillin, neomycin, methotrexate, etc.; b) complement auxotrophic deficiencies, or c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. The choice of the proper selectable marker will depend on the host cell, and appropriate markers for different hosts are well known in the art.

The vectors containing the nucleic acids of interest can be transcribed in vitro, and the resulting RNA introduced into the host cell by well-known methods, e.g., by injection (see, Kubo et al. 1988), or the vectors can be introduced directly into host cells by methods well known in the art, which vary depending on the type of cellular host, including electroporation; transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; lipofection; infection (where the vector is an infectious agent, such as a retroviral genome); and other methods. See generally, Sambrook et al, 1989 and Ausubel et al, 1992. The introduction of the polynucleotides into the host cell by any method known in the art, including inter alia, those described above, will be referred to herein as “transformation.” The cells into which have been introduced nucleic acids described above are meant to also include the progeny of such cells.

Large quantities of the nucleic acids and polypeptides of the present invention may be prepared by expressing the BRCA2 nucleic acids or portions thereof in vectors or other expression vehicles in compatible prokaryotic or eukaryotic host cells. The most commonly used prokaryotic hosts are strains of Escherichia coli, although other prokaryotes, such as Bacillus subtilis or Pseudomonas may also be used.

Mammalian or other eukaryotic host cells, such as those of yeast, filamentous fungi, plant, insect, or amphibian or avian species, may also be useful for production of the proteins of the present invention. Propagation of mammalian cells in culture is per se well known. See, Jakoby and Pastan, 1979. Examples of commonly used mammalian host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cells, and WI38. BHK, and COS cell lines, although it will be appreciated by the skilled practitioner that other cell lines may be appropriate, e.g., to provide higher expression, desirable glycosylation patterns, or other features.

Clones are selected by using markers depending on the mode of the vector construction. The marker may be on the same or a different DNA molecule, preferably the same DNA molecule. In prokaryotic hosts, the transformant may be selected, e.g., by resistance to ampicillin, tetracycline or other antibiotics. Production of a particular product based on temperature sensitivity may also serve as an appropriate marker.

Prokaryotic or eukaryotic cells transformed with the polynucleotides of the present invention will be useful not only for the production of the nucleic acids and polypeptides of the present invention, but also, for example in studying the characteristics of BRCA2 polypeptides.

Antisense polynucleotide sequences are useful in preventing or diminishing the expression of the BRCA2 locus, as will be appreciated by those skilled in the art. For example, polynucleotide vectors containing all or a portion of the BRCA2 locus or other sequences from the BRCA2 region (particularly those flanking the BRCA2 locus) may be placed under the control of a promoter in an antisense orientation and introduced into a cell. Expression of such an antisense construct within a cell will interfere with BRCA2 transcription and/or translation and/or replication.

The probes and primers based on the BRCA2 gene sequences disclosed herein are used to identify homologous BRCA2 gene sequences and proteins in other species. These BRCA2 gene sequences and proteins are used in the diagnostic/prognostic, therapeutic and drug screening methods described herein for the species from which they have been isolated.

Methods of Use: Nucleic Acid Diagnosis and Diagnostic Kits

In order to detect the presence of a BRCA2 allele predisposing an individual to cancer, a biological sample such as blood is prepared and analyzed for the presence or absence of susceptibility alleles of BRCA2. In order to detect the presence of neoplasia, the progression toward malignancy of a precursor lesion, or as a prognostic indicator, a biological sample of the lesion is prepared and analyzed for the presence or absence of mutant alleles of BRCA2. Results of these tests and interpretive information are returned to the health care provider for communication to the tested individual. Such diagnoses may be performed by diagnostic laboratories, or, alternatively, diagnostic kits are manufactured and sold to health care providers or to private individuals for self-diagnosis.

Initially, the screening method involves amplification of the relevant BRCA2 sequences. In another preferred embodiment of the invention, the screening method involves a non-PCR based strategy. Such screening methods include two-step label amplification methodologies that are well known in the art. Both PCR and non-PCR based screening strategies can detect target sequences with a high level of sensitivity.

The most popular method used today is target amplification. Here, the target nucleic acid sequence is amplified with polymerases. One particularly preferred method using polymerase-driven amplification is the polymerase chain reaction (PCR). The polymerase chain reaction and other polymerase-driven amplification assays can achieve over a million-fold increase in copy number through the use of polymerase-driven amplification cycles. Once amplified, the resulting nucleic acid can be sequenced or used as a substrate for DNA probes.

When the probes are used to detect the presence of the target sequences (for example, in screening for cancer susceptibility), the biological sample to be analyzed, such as blood or serum, may be treated, if desired, to extract the nucleic acids. The sample nucleic acid may be prepared in various ways to facilitate detection of the target sequence; e.g. denaturation, restriction digestion, electrophoresis or dot blotting. The targeted region of the analyte nucleic acid usually must be at least partially single-stranded to form hybrids with the targeting sequence of the probe. If the sequence is naturally single-stranded, denaturation will not be required. However, if the sequence is double-stranded, the sequence will probably need to be denatured. Denaturation can be carried out by various techniques known in the art.

Analyte nucleic acid and probe are incubated under conditions which promote stable hybrid formation of the target sequence in the probe with the putative targeted sequence in the analyte.

The region of the probes which is used to bind to the analyte can be made completely complementary to the targeted region of human chromosome 13. Therefore, high stringency conditions are desirable in order to prevent false positives. However, conditions of high stringency are used only if the probes are complementary to regions of the chromosome which are unique in the genome. The stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, base composition, probe length, and concentration of formamide. These factors are outlined in, for example, Maniatis el al., 1982 and Sambrook et al., 1989. Under certain circumstances, the formation of higher order hybrids, such as triplexes, quadraplexes, etc., may be desired to provide the means of detecting target sequences.

Detection, if any, of the resulting hybrid is usually accomplished by the use of labeled probes. Alternatively, the probe may be unlabeled, but may be detectable by specific binding with a ligand which is labeled, either directly or indirectly. Suitable labels, and methods for labeling probes and ligands are known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation, random priming or kinasing), biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes, particularly triggered dioxetanes), enzymes, antibodies and the like. Variations of this basic scheme are known in the art, and include those variations that facilitate separation of the hybrids to be detected from extraneous materials and/or that amplify the signal from the labeled moiety. A number of these variations are reviewed in, e.g., Matthews & Kricka, 1988, Landegren et al., 1988; Mittlin, 1989; U.S. Pat. No. 4,868,105, and in EPO Publication No. 225,807.

As noted above, non-PCR based screening assays are also contemplated in this invention. An exemplary non-PCR based procedure is provided in Example 6. This procedure hybridizes a nucleic acid probe (or an analog such as a methyl phosphonate backbone replacing the normal phosphodiester), to the low level DNA target. This probe may have an enzyme covalently linked to the probe, such that the covalent linkage does not interfere with the specificity of the hybridization. This enzyne-probe-conjugate-target nucleic acid complex can then be isolated away from the free probe enzyme conjugate and a substrate is added for enzyme detection. Enzymatic activity is observed as a change in color development or luminescent output resulting in a 10.sup.3 -10.sup.6 increase in sensitivity. For an example relating to preparation of oligodeoxynucleotide-alkaline phosphatase conjugates and their use as hybridization probes, see Jablonski et al., 1986.

Two-step label amplification methodologies are known in the art. These assays work on the principle that a small ligand (such as digoxigenin, biotin, or the like) is attached to a nucleic acid probe capable of specifically binding BRCA2. Exemplary probes can be developed on the basis of the sequence set forth in SEQ ID NO:1 and FIG. 3 of this patent application. Allele-specific probes are also contemplated within the scope of this example, and exemplary allele specific probes include probes encompassing the predisposing mutations described below, including those described in Table 2.

In one example, the small ligand attached to the nucleic acid probe is specifically recognized by an antibody-enzyme conjugate. In one embodiment of this example, digoxigenin is attached to the nucleic acid probe. Hybridization is detected by an antibody-alkaline phosphatase conjugate which turns over a chemiluminescent substrate. For methods for labeling nucleic acid probes according to this embodiment see Martin et al., 1990. In a second example, the small ligand is recognized by a second ligand-enzyme conjugate that is capable of specifically complexing to the first ligand. A well known embodiment of this example is the biotin-avidin type of interactions.

For methods for labeling nucleic acid probes and their use in biotin-avidin based assays see Rigby et al., 1977 and Nguyen et al., 1992.

It is also contemplated within the scope of this invention that the nucleic acid probe assays of this invention will employ a cocktail of nucleic acid probes capable of detecting BRCA2. Thus, in one example to detect the presence of BRCA2 in a cell sample, more than one probe complementary to BRCA2 is employed and in particular the number of different probes is alternatively 2, 3, or 5 different nucleic acid probe sequences. In another example, to detect the presence of mutations in the BRCA2 gene sequence in a patient, more than one probe complementary to BRCA2 is employed where the cocktail includes probes capable of binding to the allele-specific mutations identified in populations of patients with alterations in BRCA2. In this embodiment, any number of probes can be used, and will preferably include probes corresponding to the major gene mutations identified as predisposing an individual to breast cancer. Some candidate probes contemplated within the scope of the invention include probes that include the allele-specific mutations described below and those that have the BRCA2 regions shown in SEQ ID NO:1 and FIG. 3, both 5′ and 3′ to the mutation site.

Methods of Use: Peptide Diagnosis and Diagnostic Kits

The neoplastic condition of lesions can also be detected on the basis of the alteration of wild-type BRCA2 polypeptide. Such alterations can be determined by sequence analysis in accordance with conventional techniques. More preferably, antibodies (polyclonal or monoclonal) are used to detect differences in, or the absence of BRCA2 peptides. The antibodies may be prepared as discussed above under the heading “Antibodies” and as further shown in Examples 9 and 10. Other techniques for raising and purifying antibodies are well known in the art and any such techniques may be chosen to achieve the preparations claimed in this invention. In a preferred embodiment of the invention, antibodies will immunoprecipitate BRCA2 proteins from solution as well as react with BRCA2 protein on Western or immunoblots of polyacrylamide gels. In another preferred embodiment, antibodies will detect BRCA2 proteins in paraffin or frozen tissue sections, using immunocytochemical techniques.

Preferred embodiments relating to methods for detecting BRCA2 or its mutations include enzyme linked immunosorbent assays (ELISA), radioimmunoassays (RIA), immunoradiometric assays (IRMA) and immunoenzymatic assays (IEMA), including sandwich assays using monoclonal and/or polyclonal antibodies. Exemplary sandwich assays are described by David el al. in U.S. Pat. Nos. 4,376,110 and 4,486,530, hereby incorporated by reference, and exemplified in Example 9.

Methods of Use: Drug Screening

This invention is particularly useful for screening compounds by using the BRCA2 polypeptide or binding fragment thereof in any of a variety of drug screening techniques.

The BRCA2 polypeptide or fragment employed in such a test may either be free in solution, affixed to a solid support, or home on a cell surface. One method of drug screening utilizes eucaryotic or procaryotic host cells which are stably transformed with recombinant polynucleotides expressing the polypeptide or fragment, preferably in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays. One may measure, for example, for the formation of complexes between a BRCA2 polypeptide or fragment and the agent being tested, or examine the degree to which the formation of a complex between a BRCA2 polypeptide or fragment and a known ligand is interfered with by the agent being tested.

Thus, the present invention provides methods of screening for drugs comprising contacting such an agent with a BRCA2 polypeptide or fragment thereof and assaying (i) for the presence of a complex between the agent and the BRCA2 polypeptide or fragment, or (ii) for the presence of a complex between the BRCA2 polypeptide or fragment and a ligand, by methods well known in the art. In such competitive binding assays the BRCA2 polypeptide or fragment is typically labeled. Free BRCA2 polypeptide or fragment is separated from that present in a protein:protein complex, and the amount of free (i.e., uncomplexed) label is a measure of the binding of the agent being tested to BRCA2 or its interference with BRCA2:ligand binding, respectively.

Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to the BRCA2 polypeptides and is described in detail in Geysen, PCT published application WO 84/03564, published on Sep. 13, 1984. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with BRCA2 polypeptide and washed. Bound BRCA2 polypeptide is then detected by methods well known in the art. Purified BRCA2 can be coated directly onto plates for use in the aforementioned drug screening techniques. However non-neutralizing antibodies to the polypeptide can be used to capture antibodies to immobilize the BRCA2 polypeptide on the solid phase.

This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of specifically binding the BRCA2 polypeptide compete with a test compound for binding to the BRCA2 polypeptide or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants of the BRCA2 polypeptide.

A further technique for drug screening involves the use of host eukaryotic cell lines or cells (such as described above) which have a nonfunctional BRCA2 gene. These host cell lines or cells are defective at the BRCA2 polypeptide level. The host cell lines or cells are grown in the presence of drug compound. The rate of growth of the host cells is measured to determine if the compound is capable of regulating the growth of BRCA2 defective cells.

Methods of Use: Rational Drug Design

The goal of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact (e.g., agonists, antagonists, inhibitors) in order to fashion drugs which are, for example, more active or stable forms of the polypeptide, or which, e.g., enhance or interfere with the function of a polypeptide in vivo. See, e.g., Hodgson, 1991. In one approach, one first determines the three-dimensional structure of a protein of interest (e.g., BRCA2 polypeptide) or, for example, of the BRCA2-receptor or ligand complex, by x-ray crystallography, by computer modeling or most typically, by a combination of approaches. Less often, useful information regarding the structure of a polypeptide may be gained by modeling based on the structure of homologous proteins. An example of rational drug design is the development of HIV protease inhibitors (Erickson et al., 1990). In addition, peptides (e.g., BRCA2 polypeptide) are analyzed by an alanine scan (Wells, 1991). In this technique, an amino acid residue is replaced by Ala, and its effect on the peptide’s activity is determined. Each of the amino acid residues of the peptide is analyzed in this manner to determine the important regions of the peptide.

It is also possible to isolate a target-specific antibody, selected by a functional assay, and then to solve its crystal structure. In principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies (anti-ids) to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analog of the original receptor. The anti-id could then be used to identify and isolate peptides from banks of chemically or biologically produced banks of peptides. Selected peptides would then act as the pharmacore.

Thus, one may design drugs which have, e.g., improved BRCA2 polypeptide activity or stability or which act as inhibitors, agonists, antagonists, etc. of BRCA2 polypeptide activity. By virtue of the availability of cloned BRCA2 sequences, sufficient amounts of the BRCA2 polypeptide may be made available to perform such analytical studies as x-ray crystallography. In addition, the knowledge of the BRCA2 protein sequence provided herein will guide those employing computer modeling techniques in place of, or in addition to x-ray crystallography.

Methods of Use: Gene Therapy

According to the present invention, a method is also provided of supplying wild-type BRCA2 function to a cell which carries mutant BRCA2 alleles. Supplying such a function should suppress neoplastic growth of the recipient cells. The wild-type BRCA2 gene or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. If a gene fragment is introduced and expressed in a cell carrying a mutant BRCA2 allele, the gene fragment should encode a part of the BRCA2 protein which is required for non-neoplastic growth of the cell. More preferred is the situation where the wild-type BRCA2 gene or a part thereof is introduced into the mutant cell in such a way that it recombines with the endogenous mutant BRCA2 gene present in the cell. Such recombination requires a double recombination event which results in the correction of the BRCA2 gene mutation. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation, calcium phosphate co-precipitation and viral transduction are known in the art, and the choice of method is within the competence of the routineer. Cells transformed with the wild-type BRCA2 gene can be used as model systems to study cancer remission and drug treatments which promote such remission.

As generally discussed above, the BRCA2 gene or fragment, where applicable, may be employed in gene therapy methods in order to increase the amount of the expression products of such genes in cancer cells. Such gene therapy is particularly appropriate for use in both cancerous and pre-cancerous cells, in which the level of BRCA2 polypeptide is absent or diminished compared to normal cells. It may also be useful to increase the level of expression of a given BRCA2 gene even in those tumor cells in which the mutant gene is expressed at a “normal” level, but the gene product is not fully functional.

Gene therapy would be carried out according to generally accepted methods, for example, as described by Friedman, 1991. Cells from a patient’s tumor would be first analyzed by the diagnostic methods described above, to ascertain the production of BRCA2 polypeptide in the tumor cells. A virus or plasmid vector (see further details below), containing a copy of the BRCA2 gene linked to expression control elements and capable of replicating inside the tumor cells, is prepared. Suitable vectors are known, such as disclosed in U.S. Pat. No. 5,252,479 and PCT published application WO 93/07282. The vector is then injected into the patient, either locally at the site of the tumor or systemically (in order to reach any tumor cells that may have metastasized to other sites). If the transfected gene is not permanently incorporated into the genome of each of the targeted tumor cells, the treatment may have to be repeated periodically.

Gene transfer systems known in the art may be useful in the practice of the gene therapy methods of the present invention. These include viral and nonviral transfer methods. A number of viruses have been used as gene transfer vectors, including papovaviruses, e.g., SV40 (Madzak et al., 1992), adenovirus (Berkner, 1992; Berkner et al., 1988; Gorziglia and Kapikian, 1992; Quantin et al., 1992; Rosenfeld et al., 1992; Wilkinson et al., 1992; Stratford-Perricaudet et al., 1990), vaccinia virus (Moss, 1992), adeno-associated virus (Muzyczka, 1992; Ohi el al., 1990), herpesviruses including HSV and EBV (Margolskee, 1992; Johnson et al., 1992; Fink et al., 1992; Breakfield and Geller, 1987; Freese et al., 1990), and retroviruses of avian (Brandyopadhyay and Temin, 1984; Petropoulos et al., 1992), murine (Miller, 1992; Miller et al., 1985; Sorge et al., 1984; Mann and Baltimore. 1985; Miller el al., 1988), and human origin (Shimada et al., 1991; Helseth et al., 1990; Page et al., 1990; Buchschacher and Panganiban, 1992). Most human gene therapy protocols have been based on disabled murine retroviruses.

Nonviral gene transfer methods known in the art include chemical techniques such as calcium phosphate coprecipitation (Graham and van der Eb, 1973; Pellicer et al., 1980); mechanical techniques, for example microinjection (Anderson et al., 1980; Gordon et al., 1980; Brinster el al., 1981; Constantini and Lacy, 1981); membrane fusion-mediated transfer via liposomes (Felgner et al., 1987; Wang and Huang, 1989; Kaneda et al, 1989; Stewart et al., 1992; Nabel et al., 1990; Lim el al., 1992); and direct DNA uptake and receptor-mediated DNA transfer (Wolff el al., 1990; Wu el al. 1991; Zenke el al., 1990; Wu et al., 1989b; Wolff et al., 1991; Wagner et al., 1990; Wagner el al., 1991; Cotten el al., 1990; Curiel et al., 1991a; Curiel et al., 1991b). Viral-mediated gene transfer can be combined with direct in vivo gene transfer using liposome delivery, allowing one to direct the viral vectors to the tumor cells and not into the surrounding nondividing cells. Alternatively, the retroviral vector producer cell line can be injected into tumors (Culver et al., 1992). Injection of producer cells would then provide a continuous source of vector particles. This technique has been approved for use in humans with inoperable brain tumors.

In an approach which combines biological and physical gene transfer methods, plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein, and the resulting complex is bound to an adenovirus vector. The trimolecular complex is then used to infect cells. The adenovirus vector permits efficient binding, internalization, and degradation of the endosome before the coupled DNA is damaged.

Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is nonspecific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration (Nabel, 1992).

Gene transfer techniques which target DNA directly to breast and ovarian tissues, e.g., epithelial cells of the breast or ovaries, is preferred. Receptor-mediated gene transfer, for example, is accomplished by the conjugation of DNA (usually in the form of covalently closed supercoiled plasmid) to a protein ligand via polylysine. Ligands are chosen on the basis of the presence of the corresponding ligand receptors on the cell surface of the target cell/tissue type. One appropriate receptor/ligand pair may include the estrogen receptor and its ligand, estrogen (and estrogen analogues). These ligand-DNA conjugates can be injected directly into the blood if desired and are directed to the target tissue where receptor binding and internalization of the DNA-protein complex occurs. To overcome the problem of intracellular destruction of DNA, coinfection with adenovirus can be included to disrupt endosome function.

The therapy involves two steps which can be performed singly or jointly. In the first step, prepubescent females who carry a BRCA2 susceptibility allele are treated with a gene delivery vehicle such that some or all of their mammary ductal epithelial precursor cells receive at least one additional copy of a functional normal BRCA2 allele. In this step, the treated individuals have reduced risk of breast cancer to the extent that the effect of the susceptible allele has been countered by the presence of the normal allele. In the second step of a preventive therapy, predisposed young females, in particular women who have received the proposed gene therapeutic treatment, undergo hormonal therapy to mimic the effects on the breast of a full term pregnancy.

Methods of Use: Peptide Therapy

Peptides which have BRCA2 activity can be supplied to cells which carry mutant or missing BRCA2 alleles. The sequence of the BRCA2 protein is disclosed in SEQ ID NO:2. Protein can be produced by expression of the cDNA sequence in bacteria, for example, using known expression vectors. Alternatively, BRCA2 polypeptide can be extracted from BRCA2-producing mammalian cells. In addition, the techniques of synthetic chemistry can be employed to synthesize BRCA2 protein. Any of such techniques can provide the preparation of the present invention which comprises the BRCA2 protein. The preparation is substantially free of other human proteins. This is most readily accomplished by synthesis in a microorganism or in vitro.

Active BRCA2 molecules can be introduced into cells by microinjection or by use of liposomes, for example. Alternatively, some active molecules may be taken up by cells, actively or by diffusion. Extracellular application of the BRCA2 gene product may be sufficient to affect tumor growth. Supply of molecules with BRCA2 activity should lead to partial reversal of the neoplastic state. Other molecules with BRCA2 activity (for example, peptides, drugs or organic compounds) may also be used to effect such a reversal. Modified polypeptides having substantially similar function are also used for peptide therapy.

Methods of Use: Transformed Hosts

Similarly, cells and animals which carry a mutant BRCA2 allele can be used as model systems to study and test for substances which have potential as therapeutic agents. The cells are typically cultured epithelial cells. These may be isolated from individuals with BRCA2 mutations, either somatic or germline. Alternatively, the cell line can be engineered to carry the mutation in the BRCA2 allele, as described above. After a test substance is applied to the cells, the neoplastically transformed phenotype of the cell is determined. Any trait of neoplastically transformed cells can be assessed, including anchorage-independent growth, tumorigenicity in nude mice, invasiveness of cells, and growth factor dependence. Assays for each of these traits are known in the art.

Animals for testing therapeutic agents can be selected after mutagenesis of whole animals or after treatment of germline cells or zygotes. Such treatments include insertion of mutant BRCA2 alleles, usually from a second animal species, as well as insertion of disrupted homologous genes.

Alternatively, the endogenous BRCA2 gene(s) of the animals may be disrupted by insertion or deletion mutation or other genetic alterations using conventional techniques (Capecchi, 1989; Valancius and Smithies, 1991; Hasty et al., 1991; Shinkai et al., 1992; Mombaerts et al., 1992; Philpott el al., 1992; Snouwaert et al., 1992; Donehower el al., 1992). After test substances have been administered to the animals, the growth of tumors must be assessed. If the test substance prevents or suppresses the growth of tumors, then the test substance is a candidate therapeutic agent for the treatment of the cancers identified herein. These animal models provide an extremely important testing vehicle for potential therapeutic products.

The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well known in the art or the techniques specifically described below were utilized.

EXAMPLE 1

Ascertain and Study Kindreds Likely to Have a Chromosome 13-Linked Breast Cancer Susceptibility Locus

Extensive cancer prone kindreds were ascertained from a defined population providing a large set of extended kindreds with multiple cases of breast cancer and many relatives available to study. The large number of meioses present in these large kindreds provided the power to detect whether the BRCA2 locus was segregating, and increased the opportunity for informative recombinants to occur within the small region being investigated. This vastly improved the chances of establishing linkage to the BRCA2 region, and greatly facilitated the reduction of the BRCA2 region to a manageable size, which permits identification of the BRCA2 locus itself.

Each kindred was extended through all available connecting relatives, and to all informative first degree relatives of each proband or cancer case. For these kindreds, additional breast cancer cases and individuals with cancer at other sites of interest who also appeared in the kindreds were identified through the tumor registry linked files. All breast cancers reported in the kindred which were not confirmed in the Utah Cancer Registry were researched. Medical records or death certificates were obtained for confirmation of all cancers. Each key connecting individual and all informative individuals were invited to participate by providing a blood sample from which DNA was extracted. We also sampled spouses and relatives of deceased cases so that the genotype of the deceased cases could be inferred from the genotypes of their relatives.

Kindreds which had three or more cancer cases with inferable genotypes were selected for linkage studies to chromosome 13 markers. These included kindreds originally ascertained from the linked databases for a study of proliferative breast disease and breast cancer (Skolnick et al., 1990). The criterion for selection of these kindreds was the presence of two sisters or a mother and her daughter with breast cancer. Additionally, kindreds which have been studied since 1980 as part of our breast cancer linkage studies and kindreds ascertained from the linked databases for the presence of clusters of male and female breast cancer and self-referred kindreds with early onset breast cancer were included. These kindreds were investigated and expanded in our clinic in the manner described above.

For each sample collected in these kindreds, DNA was extracted from blood or paraffin-embedded tissue blocks using standard laboratory protocols. Genotyping in this study was restricted to short tandem repeat (STR) markers since, in general, they have high heterozygosity and PCR methods offer rapid turnaround while using very small amounts of DNA. To aid in this effort, STR markers on chromosome 13 were developed by screening a chromosome specific cosmid library for clones which contained short tandem repeats of 2, 3 or 4, localized to the short arm in the region of the Rb tumor suppressor locus. Oligonucleotide sequences for markers not developed in our laboratory were obtained from published reports, or as part of the Breast Cancer Linkage Consortium, or from other investigators. All genotyping films were scored blindly with a standard lane marker used to maintain consistent coding of alleles. Key samples underwent duplicate typing for all relevant markers.

LOD scores for each kindred were calculated for two recombination fraction values, 0.001 and 0.1. (For calculation of LOD scores, see Ott 1985). Likelihoods were computed under the model derived by Claus et al., 1991, which assumes an estimated gene frequency of 0.003, a lifetime risk in female gene carriers of about 0.80, and population based age-specific risks for breast cancer in non-gene carriers. Allele frequencies for the markers used for the LOD score calculations were calculated from our own laboratory typings of unrelated individuals in the CEPH panel (White and Lalouel, 1988).

Kindred 107 is the largest chromosome 13-linked breast cancer family reported to date by any group. The evidence of linkage to chromosome 13 for this family is overwhelming. In smaller kindreds, sporadic cancers greatly confound the analysis of linkage and the correct identification of key recombinants.

In order to improve the characterization of our recombinants and define closer flanking markers, a dense map of this relatively small region on chromosome 13 was required. Our approach was to analyze existing STR markers provided by other investigators and any newly developed markers from our laboratory in our chromosome linked kindreds. FIG. 1 shows the location of ten markers used in the genetic analysis. Table 1 gives the LOD scores for linkage for each of the 19 kindreds in our study, which reduced the region to approximately 1.5 Mb.

TABLE 1 __________________________________________________________________________ Haplotype and Phenotype Data for the 18 Families STRs Examined Number of Cancer Cases(1) Posterior tdj D13S mb D13S 5370- D13S D13S Kindred FBR MBR OV LOD Probability (2) 3820 4247 260 GA9 561 171 2C A6C 310 267 __________________________________________________________________________ 107* 22 3 2 5.06 1.00 8 28 4 10 8 3 2 6 4 12 8001 0 3 0 n.d. 0.90 8 30 6 10 7 10 5 5 5 4 8004 1 2 0 n.d. 0.90 9 11 4 4 7 8 6 8 4 12 2044* 8 1 4 2.13 1.00 9 12 10 7 5 9 6 5 4 8 2043* 2 1 1 0.86 0.98 6 30 3 12 7 10 5 8 4 12 2018 3 1 0 n.d. 0.90 9 12 7 3 8 3 6 6 5 8 937 3 1 0 n.d. 0.90 8 10 4 — – 8 10 6 7 7 1018* 9 1 0 2.47 1.00 6 17 8 10 5 8 2 5 4 8 2328 11 1 0 0.42 0.96 9 10 3 10 5 8 5 5 7 12 2263 2 1 0 n.d. 0.90 9 28 8 — 8 4 — – 7 12 8002 2 1 0 n.d. 0.90 3 29 7 10 5 8 5 5 5 8 8003 2 1 0 n.d. 0.90 4 12 6 10 6 3 4 5 4 8 2367 6 0 1 0.40 0.85 6 28 7 10 12 3 7 5 5 4 2388 3 0 1 0.92 0.95 8 16 7 12 4 10 4 5 5 12 2027* 4 0 0 0.39 0.85 4 11 3 10 7 10 5 6 7 12 4328 4 0 0 0.44 0.87 9 10 8 4 8 3 7 8 5 12 2355 3 0 0 0.36 0.84 9 10 6 4 6 3 7 3 5 8 2327 11 0 0 1.92 0.99 3 12 2 9 5 10 5 5 3 4 1019 2 2 0 __________________________________________________________________________ *Families reported in Wooster et al. (1994). n.d. = not determined (1)Excludes cases known to be sporadic (i.e., do not share the BRCA2 haplotype segregating in the family). FBR = female breast cancer under 60 years. MBR = male breast cancer OV = ovarian cancer (2) Posterior probability assumes that, a priori, 90% of families with male breast and early onset female breast cancers that are unlinked to BRCA1 are due to BRCA2, and 70% of female breast cancer families unlinked to BRCA1 are due to BRCA1.

Table 1 also gives the posterior probability of a kindred having a BRCA2 mutation based on LOD scores and prior probabilities. Four of these markers (D13S171, D13S260, D13S310 and D13S267) were previously known. The other six markers were found as part of our search for BRCA2. We were able to reduce the region to 1.5 megabases based on a recombinant in Kindred 107 with marker tdj3820 at the left boundary, and a second recombinant in Kindred 2043 with marker YS-G-B10T at the right boundary (see FIG. 1) which is at approximately the same location as AC6 and D13S3 10. Furthermore, a homozygous deletion was found in a pancreatic tumor cell line in the BRCA2 region which may have been driven by BRCA2 itself; this deletion is referred to as the Schutte/Kern deletion in FIG. 1 (Schutte et al., 1995). The Schutte/Kern contig in FIG. 1 refers to these authors’ physical map which covers the deletion.

EXAMPLE 2

Development of Genetic and Physical Resources in the Region of Interest

To increase the number of highly polymorphic loci in the BRCA2 region, we developed a number of STR markers in our laboratory from P1s, BACs and YACs which physically map to the region. These markers allowed us to further refine the region (see Table 1 and the discussion above).

STSs in the desired region were used to identify YACs which contained them. These YACs were then used to identify subclones in P1s or BACs. These subclones were then screened for the presence of a short tandem repeats. Clones with a strong signal were selected preferentially, since they were more likely to represent repeats which have a large number of repeats and/or are of near-perfect fidelity to the pattern. Both of these characteristics are known to increase the probability of polymorphism (Weber et al., 1990). These clones were sequenced directly from the vector to locate the repeat. We obtained a unique sequence on one side of the short tandem repeat by using one of a set of possible primers complementary to the end of the repeat. Based on this unique sequence, a primer was made to sequence back across the repeat in the other direction, yielding a unique sequence for design of a second primer flanking it. STRs were then screened for polymorphism on a small group of unrelated individuals and tested against the hybrid panel to confirm their physical localization. New markers which satisfied these criteria were then typed in a set of unrelated individuals from Utah to obtain allele frequencies appropriate for the study of this population. Many of the other markers reported in this study were also tested in unrelated individuals to obtain similarly appropriate allele frequencies.

Using the procedure described above, novel STRs were found from these YACs which were both polymorphic and localized to the BRCA2 region. FIG. 1 shows a schematic map of STSs, P1s. BACs and YACs in the BRCA2 region.

EXAMPLE 3

Identification of Candidate cDNA Clones for the BRCA2 Locus by Genomic Analysis of the Contig Region

1. General Methods

Complete screen of the plausible region. The first method to identify candidate cDNAs, although labor intensive, used known techniques. The method comprised the screening of P1 and BAC clones in the contig to identify putative coding sequences. The clones containing putative coding sequences were then used as probes on filters of cDNA libraries to identify candidate cDNA clones for future analysis. The clones were screened for putative coding sequences by either of two methods.

The P1 clones to be analyzed were digested with a restriction enzyme to release the human DNA from the vector DNA. The DNA was separated on a 14 cm, 0.5% agarose gel run overnight at 20 volts for 16 hours. The human DNA bands were cut out of the gel and electroeluted from the gel wedge at 100 volts for at least two hours in 0.5.times. Tris Acetate buffer (Maniatis et al., 1982).

The eluted Not I digested DNA (.about.15 kb to 25 kb) was then digested with EcoRI restriction enzyme to give smaller fragments (.about.0.5 kb to 5.0 kb) which melt apart more easily for the next step of labeling the DNA with radionucleotides. The DNA fragments were labeled by means of the hexamer random prime labeling method (Boehringer-Mannheim, Cat. #1004760). The labeled DNA was spermine precipitated (add 100 .mu.l TE, 5 .mu.l 0.1 M spermine, and 5 .mu.l of 10 mg/ml salmon sperm DNA) to remove unincorporated radionucleotides. The labeled DNA was then resuspended in 100 .mu.l TE, 0.5 M NaCl at 65.degree. C. for 5 minutes and then blocked with Human C.sub.o t-1 DNA for 2-4 hrs. as per the manufacturer’s instructions (Gibco/BRL, Cat. #5279SA). The C.sub.o t-1 blocked probe was incubated on the filters in the blocking solution overnight at 42.degree. C. The filters were washed for 30 minutes at room temperature in 2.times.SSC, 0.1% SDS, and then in the same buffer for 30 minutes at 55.degree. C. The filters were then exposed 1 to 3 days at -70.degree. C. to Kodak XAR-5 film with an intensifying screen. Thus, the blots were hybridized with either the pool of Eco-RI fragments from the insert, or each of the fragments individually.

The human DNA from clones in the region was isolated as whole insert or as EcoRI fragments and labeled as described above. The labeled DNA was used to screen filters of various cDNA libraries under the same conditions described above except that the cDNA filters undergo a more stringent wash of 0.1.times.SSC, 0.1% SDS at 65.degree. C. for 30 minutes twice.

Most of the cDNA libraries used to date in our studies (libraries from normal breast tissue, breast tissue from a woman in her eighth month of pregnancy and a breast malignancy) were prepared at Clonetech, Inc. The cDNA library generated from breast tissue of an 8 month pregnant woman is available from Clonetech (Cat. #HL1037a) in the Lambda gt-10 vector, and is grown in C600Hf1 bacterial host cells. Normal breast tissue and malignant breast tissue samples were isolated from a 37 year old Caucasian female and one-gram of each tissue was sent to Clonetech for mRNA processing and cDNA library construction. The latter two libraries were generated using both random and oligo-dT priming, with size selection of the final products which were then cloned into the Lambda Zap II vector, and grown in XL1-blue strain of bacteria as described by the manufacturer. Additional tissue-specific cDNA libraries include human fetal brain (Stratagene, Cat. 936206), human testis (Clonetech Cat. HL3024), human thymus (Clonetech Cat. HL1127n), human brain (Clonetech Cat. HL11810), human placenta (Clonetech Cat 1075b), and human skeletal muscle (Clonetech Cat. HL1124b).

The cDNA libraries were plated with their host cells on NZCYM plates, and filter lifts are made in duplicate from each plate as per Maniatis et al. (1982). Insert (human) DNA from the candidate genomic clones was purified and radioactively labeled to high specific activity. The radioactive DNA was then hybridized to the cDNA filters to identify those cDNAs which correspond to genes located within the candidate cosmid clone. cDNAs identified by this method were picked, replated, and screened again with the labeled clone insert or its derived EcoRI fragment DNA to verify their positive status. Clones that were positive after this second round of screening were then grown up and their DNA purified for Southern blot analysis and sequencing. Clones were either purified as plasmid through in vivo excision of the plasmid from the Lambda vector as described in the protocols from the manufacturers, or isolated from the Lambda vector as a restriction fragment and subcloned into plasmid vector.

The Southern blot analysis was performed in duplicate, one using the original genomic insert DNA as a probe to verify that cDNA insert contains hybridizing sequences. The second blot was hybridized with cDNA insert DNA from the largest cDNA clone to identify which clones represent the same gene. All cDNAs which hybridize with the genomic clone and are unique were sequenced and the DNA analyzed to determine if the sequences represent known or unique genes.

All cDNA clones which appear to be unique were further analyzed as candidate BRCA2 loci. Specifically, the clones are hybridized to Northern blots to look for breast specific expression and differential expression in normal versus breast tumor RNAs. They are also analyzed by PCR on =clones in the BRCA2 region to verify their location. To map the extent of the locus, full length cDNAs are isolated and their sequences used as PCR probes on the YACs and the clones surrounding and including the original identifying clones. Intron-exon boundaries are then further defined through sequence analysis.

We have screened the normal breast, 8 month pregnant breast and fetal brain cDNA libraries with Eco RI fragments from cosmid BAC and P1 clones in the region. Potential BRCA2 cDNA clones were identified among the three libraries. Clones were picked, replated, and screened again with the original probe to verify that they were positive.

Analysis of hybrid-selected cDNA. cDNA fragments obtained from direct selection were checked by Southern blot hybridization against the probe DNA to verify that they originated from the contig. Those that passed this test were sequenced in their entirety. The set of DNA sequences obtained in this way were then checked against each other to find independent clones that overlapped.

The direct selection of cDNA method (Lovett et al., 1991; Futreal, 1993) is utilized with P1 and BAC DNA as the probe. The probe DNA is digested with a blunt cutting restriction enzyme such as HaeIII. Double-stranded adapters are then ligated onto the DNA and serve as binding sites for primers in subsequent PCR amplification reactions using biotinylated primers. Target cDNA is (generated from mRNA derived from tissue samples, e.g., breast tissue, by synthesis of either random primed or oligo(dT) primed first strand, followed by second strand synthesis. The cDNA ends are rendered blunt and ligated onto double-stranded adapters. These adapters serve as amplification sites for PCR. The target and probe sequences are denatured and mixed with human C.sub.o t-1 DNA to block repetitive sequences. Solution hybridization is carried out to high C.sub.o t-1/2 values to ensure hybridization of rare target cDNA molecules. The annealed material is then captured on avidin beads, washed at high stringency and the retained cDNAs are eluted and amplified by PCR. The selected cDNA is subjected to further rounds of enrichment before cloning into a plasmid vector for analysis.

HTF island analysis. A method for identifying cosmids to use as probes on the cDNA libraries was HTF island analysis. HTF islands are segments of DNA which contain a very high frequency of unmethylated CpG dinucleotides (Tonolio et al., 1990) and are revealed by the clustering of restriction sites of enzymes whose recognition sequences include CpG dinucleotides. Enzymes known to be useful in HTF-island analysis are AscI, NotI, BssHII, EagI, SacII, NaeI, NarI, SmaI, and MluI (Anand, 1992).

Analysis of candidate clones. One or more of the candidate genes generated from above were sequenced and the information used for identification and classification of each expressed gene. The DNA sequences were compared to known genes by nucleotide sequence comparisons and by translation in all frames followed by a comparison with known amino acid sequences. This was accomplished using Genetic Data Environment (GDE) version 2.2 software and the Basic Local Alignment Search Tool (Blast) series of client/server software packages (e.g., BLASTN 1.3.13MP), for sequence comparison against both local and remote sequence databases (e.g., GenBank), running on Sun SPARC workstations. Sequences reconstructed from collections of cDNA clones identified with the cosmids and P1s have been generated. All candidate genes that represented new sequences were analyzed further to test their candidacy for the putative BRCA2 locus.

Mutation screening. To screen for mutations in the affected pedigrees, two different approaches were followed. First, genomic DNA isolated from family members known to carry the susceptibility allele of BRCA2 was used as a template for amplification of candidate gene sequences by PCR. If the PCR primers flank or overlap an intron/exon boundary, the amplified fragment will be larger than predicted from the cDNA sequence or will not be present in the amplified mixture. By a combination of such amplification experiments and sequencing of P1 or BAC clones using the set of designed primers it is possible to establish the intron/exon structure and ultimately obtain the DNA sequences of genomic DNA from the kindreds.

A second approach that is much more rapid if the intron/exon structure of the candidate gene is complex involves sequencing fragments amplified from cDNA synthesized from lymphocyte mRNA extracted from pedigree blood which was used as a substrate for PCR amplification using the set of designed primers. If the candidate gene is expressed to a significant extent in lymphocytes, such experiments usually produce amplified fragments that can be sequenced directly without knowledge of intron/exon junctions.

The products of such sequencing reactions were analyzed by gel electrophoresis to determine positions in the sequence that contain either mutations such as deletions or insertions, or base pair substitutions that cause amino acid changes or other detrimental effects.

Any sequence within the BRCA2 region that is expressed in breast is considered to be a =candidate gene for BRCA2. Compelling evidence that a given candidate gene corresponds to BRCA2 comes from a demonstration that kindred families contain defective alleles of the candidate.

2. Specific Methods

Hybrid selection. Two distinct methods of hybrid selection were used in this work.

Method 1: cDNA preparation and selection. Randomly primed cDNA was prepared from poly (A).sup.+ RNA of mammary gland, ovary testis, fetal brain and placenta tissues and from total RNA of the cell line Caco-2 (ATCC HTB 37). cDNAs were homopolymer tailed and then hybrid selected for two consecutive rounds of hybridization to immobilized P1 or BAC DNA as described previously. (Parimoo et al., 1991; Rommens et al., 1994). Groups of two to four overlapping P1 and/or BAC clones were used in individual selection experiments. Hybridizing cDNA was collected, passed over a G50 Fine Sephadex column and amplified using tailed primers. The products were then digested with EcoRI, size selected on agarose gels, and ligated into pBluescript (Stratagene) that had been digested with EcoRI and treated with calf alkaline phosphatase (Boehringer Mannheim). Ligation products were transformed into competent DH5.alpha. E. coli cells (Life Technologies, Inc.).

Characterization of Retrieved cDNAs. 200 to 300 individual colonies from each ligation (from each 250 kbases of genomic DNA) were picked and gridded into microtiter plates for ordering and storage. Cultures were replica transferred onto Hybond N membranes (Amersham) supported by LB agar with ampicillin. Colonies were allowed to propagate and were subsequently lysed with standard procedures. Initial analysis of the cDNA clones involved a prescreen for ribosomal sequences and subsequent cross screenings for detection of overlap and redundancy.

Approximately 10-25% of the clones were eliminated as they hybridized strongly with radiolabeled cDNA obtained from total RNA. Plasmids from 25 to 50 clones from each selection experiment that did not hybridize in prescreening were isolated for further analysis. The retrieved cDNA fragments were verified to originate from individual starting genomic clones by hybridization to restriction digests of DNAs of the starting clones, of a hamster hybrid cell line (GM10898A) that contains chromosome 13 as its only human material and to human genomic DNA. The clones were tentatively assigned into groups based on the overlapping or non-overlapping intervals of the genomic clones. Of the clones tested, approximately 85% mapped appropriately to the starting clones.

Method 2 (Lovett et al., 1991): cDNA Preparation. Poly(A) enriched RNA from human mammary gland, brain, lymphocyte and stomach were reverse-transcribed using the tailed random primer XN.sub.12

and Superscript II reverse transcriptase (Gibco BRL). After second strand synthesis and end polishing, the ds cDNA was purified on Sepharose CL-4B columns (Pharmacia). cDNAs were “anchored” by ligation of a double-stranded oligo RP

annealed to

to their 5′ ends (5′ relative to mRNA) using T4 DNA ligase. Anchored ds cDNA was then repurified on Sepharose CL-4B columns.

Selection. cDNAs from mammary gland, brain, lymphocyte and stomach tissues were first amplified using a nested version of RP

and purified by fractionation on Sepharose CL-4B. Selection probes were prepared from purified P1s, BACs or PACs by digestion with HinfI and Exonuclease III. The single-stranded probe was photolabelled with photobiotin (Gibco BRL) according to the manufacturer’s recommendations. Probe, cDNA and Cot-1 DNA were hybridized in 2.4M TEA-CL, 10 mM NaPO.sub.4, 1 mM EDTA. Hybridized cDNAs were captured on streptavidin-paramagnetic particles (Dynal), eluted, reamplified with a further nested version of RP

and XPCR, and size-selected on Sepharose CL-6B. The selected, amplified cDNA was hybridized with an additional aliquot of probe and C.sub.o t-1 DNA. Captured and eluted products were amplified again with RP.B and XPCR, size-selected by gel electrophoresis and cloned into dephosphorylated HincII cut pUC18. Ligation products were transformed into XL2-Blue ultra-competent cells (Stratagene).

Analysis. Approximately 192 colonies for each single-probe selection experiment were amplified by colony PCR using vector primers and blotted in duplicate onto Zeta Probe nylon filters (Bio-Rad). The filters were hybridized using standard procedures with either random primed C.sub.o t-1 DNA or probe DNA (P1, BAC or PAC). Probe-positive, C.sub.o t-1 negative clones were sequenced in both directions using vector primers on an ABI 377 sequencer.

Exon Trapping. Exon amplification was performed using a minimally overlapping set of BACs, P1s and PACs in order to isolate a number of gene sequences from the BRCA2 candidate region. Pools of genomic clones were assembled, containing from 100-300 kb of DNA in the form of 1-3 overlapping genomic clones. Genomic clones were digested with PstI or BamHI+BgIII and ligated into PstI or BamHI sites of the pSPL3 splicing vector. The exon amplification technique was performed (Church et al., 1993) and the end products were cloned in the pAMP1 plasmid from the Uracil DNA Glycosylase cloning system (BRL). Approximately 6000 clones were picked, propagated in 96 well plates, stamped onto filters, and analyzed for the presence of vector and repeat sequences by hybridization. Each clone insert was PCR amplified and tested for redundancy, localization and human specificity by hybridization to grids of exons and dot blots of the parent genomic DNA. Unique candidate exons were sequenced, searched against the databases, and used for hybridization to cDNA libraries.

5′ RACE. The 5′ end of BRCA2 was identified by a modified RACE protocol called biotin capture RACE. Poly(A) enriched RNA from human mammary gland and thymus was reverse-transcribed using the tailed random primer XN.sub.12

and Superscript II reverse transcriptase (Gibco BRL). The RNA strand was hydrolyzed in NaOH and first strand cDNA purified by fractionation on Sepharose CL-4B (Pharmacia). First strand cDNAs were “anchored” by ligation of a double-stranded oligo with a 7 bp random 5′ overhang [ds UCA: 5'-CCTTCACACGCGTATCGATTAGTCACNNNNNNN-(NH.sub.2) (SEQ ID NO:9) annealed to 5'-(PO.sub.4)-GTGACTAATCGATACGCGTGTGAAGGTGC (SEQ ID NO:10)] to their 3′ ends using T4 DNA ligase. After ligation, the anchored cDNA was repurified by fractionation on Sepharose CL-4B. The 5′ end of BRCA2 was amplified using a biotinylated reverse primer [5'-(B)-TTGAAGAACAACAGGACTTTCACTA] (SEQ ID NO:11) and a nested version of UCA [UCP.A: 5'-CACCTTCACACGCGTATCG (SEQ ID NO:12)]. PCR products were fractionated. on an agarose gel, gel purified, and captured on streptavidin-paramagnetic particles (Dynal). Captured cDNA was reamplified using a nested reverse primer [5'-GTTCGTAATTGTTGTTTTTATGTTCAG] (SEQ ID NO:13) and a further nested version of UCA [UCP.B: 5'-CCTTCACACGCGTATCGATTAG] (SEQ ID NO:14)]. This PCR reaction gave a single sharp band on an agarose gel; the DNA was gel purified and sequenced in both directions on an ABI 377 sequencer.

cDNA Clones. Human cDNA libraries were screened with .sup.32 P-labeled hybrid selected or exon trapped clones. Phage eluted from tertiary plaques were PCR amplified with vector-specific primers and then sequenced on an ABI 377 sequencer.

Northern Blots. Multiple Tissue Northern (MTN) filters, which are loaded with 2 .mu.g per lane of poly(A)+RNA derived from a number of human tissues, were purchased from Clonetech. .sup.32 P-random-primer labeled probes corresponding to retrieved cDNAs GT 713 (BRCA2 exons 3-7), k wCPF1B8.1 (3′ end of exon 11 into exon 20), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used to probe the filters. Prehybridizations were at 42.degree. C. in 50% formamide, 5.times.SSPE, 1% SDS, 5.times.Denhardt’s mixture, 0.2 mg/ml denatured salmon testis DNA and 2 .mu.g/ml poly(A). Hybridizations were in the same solution with the addition of dextran sulfate to 4% and probe. Stringency washes were in 0.1.times.SSC/0.1% SDS at

RT-PCR Analysis. Ten .mu.g of total RNA extracted from five human breast cancer cell lines (ZR-75-1, T-47D, MDA-MB-231, MDA-MB468 and BT-20) and three human prostate cancer cell lines (LNCaP, DU145 and PC-3) (RNAs provided by Dr. Claude Labrie, CHUL Research Center) were reverse transcribed using the primer mH20-D105#RA

and Superscript II reverse transcriptase (Gibco BRL). Thereafter, the single strand cDNAs were amplified using the primers CG0269FB:

and mH20-1D05#RA (this is the primer pair that was used to island hop from the exon 7/8 junction into exon 11; the PCR product is about 1.55 kb). PCR products were fractionated on a 1.2% agarose gel.

PCR Amplification and Mutation Screening. All 26 coding exons of BRCA2 and their associated splice sites were amplified from genomic DNA as described (Kamb et al., 1994b). The DNA sequences of the primers, some of which lie in flanking intron sequence, used for amplification and sequencing appear in Table 2. Some of the exons (2 through 10, 11-5, 11-6, 11-7 and 23 through 27) were amplified by a simple one-step method. The PCR conditions for those exons were: single denaturing step of 95.degree. C. (1 min.); 40 cycles of 96.degree. C. (6 sec.), T.sub.ann. =55.degree. C. (15 sec.), 72.degree. C. (1 min.). Other exons (11-22) required nested reamplification after the primary PCR reaction. In these cases, the initial amplification was carried out with the primers in the first two columns of Table 2 for 19 cycles as described above. Nested reamplification for these exons was carried out for 28 or 32 cycles at the same conditions with the primers appearing in the third column of Table 2. The buffer conditions were as described (Kamb et al., 1994b). The products were purified from 0.8% agarose gels using Qiaex beads (Qiagen). The purified products were analyzed by cycle sequencing with .alpha.-P.sup.32 dATP with Ampli-Cycle.TM. Sequencing Kit (Perkin Elmer, Branchburg, N.J.). The reaction products were fractionated on 6% polyacrylamide gels. All (A) reactions were loaded adjacent each other, followed by the (C) reactions, etc. Detection of polymorphisms was carried out visually and confirmed on the other strand.

TABLE 2 __________________________________________________________________________ Primers for Amplifying BRCA2 Exons EXON FORWARD PRIMER REVERSE PRIMER NESTED PRIMER __________________________________________________________________________ 2 TGTTCCCATCCTCACAGTAAG*.sup.(17) GTACTGGGTTTTTAGCAAGCA*.sup.(18) 3 GGTTAAAACTAAGGTGGGA*.sup.(19) ATTTGCCCAGCATGACACA*.sup.(20) 4 TTTCCCAGTATAGAGGAGA*.sup.(21) GTAGGAAAATGTTTCATTTAA*.sup.(22) 5 ATCTAAAGTAGTATTCCAACA*.sup.(23) GGGGGTAAAAAAAGGGGAA*.sup.(24) 6 GAGATAAGTCAGGTATGATT*.sup.(25) AATTGCCTGTATGAGGCAGA*.sup.(26) 7 GGCAATTCAGTAAACGTTAA*.sup.(27) ATTGTCAGTTACTAACACAC*.sup.(28) 8 GTGTCATGTAATCAAATAGT*.sup.(29) CAGGTTTAGAGACTTTCTC*.sup.(30) 9 GGACCTAGGTTGATTGCA*.sup.(31) GTCAAGAAAGGTAAGGTAA*.sup.(32) 10-1 CTATGAGAAAGGTTGTGAG*.sup.(33) CCTAGTCTTGCTAGTTCTT*.sup.(34) 10-2 AACAGTTGTAGATACCTCTGAA*.sup.(35) GACTTTTTGATACCCTGAAATG*.sup.(36) 10-3 CAGCATCTTGAATCTCATACAG*.sup.(37) CATGTATACAGATGATGCCTAAG*.sup.(38) 11-1 AACTTAGTGAAAAATATTTAGTGA.sup.(39) ATACATCTTGATTCTTTTCCAT*.sup.(40) TTTAGTGAATGTGATTGATGGT*.sup.(4 1) 11-2 AGAACCAACTTTGTCCTTAA.sup.(42) TTAGATTTGTGTTTTGGTTGAA*.sup.(43) TAGCTCTTTTGGGACAATTC*.sup.(44) 11-3 ATGGAAAAGAATCAAGATGTAT*.sup.(45) CCTAATGTTATGTTCAGAGAG.sup.(46) GCTACCTCCAAAACTGTGA*.sup.(47) 11-4 GTGTAAAGCAGCATATAAAAAT*.sup.(48) CTTGCTGCTGTCTACCTG.sup.(49) AGTGGTCTTAAGATAGTCAT*.sup.(50) 11-5 CCATAATTTAACACCTAGCCA**.sup.51) CCAAAAAAGTTAAATCTGACA**.sup.(52) GGCTTTTATTCTGCTCATGGC*.sup.(53) CCTCTGCAGAAGTTTCCTCAC*.sup.(54) 11-6 AACGGACTTGCTATTTACTGA*.sup.(55) AGTACCTTGCTCTTTTTCATC*.sup.(56) 11-7 CAGCTAGCGGGAAAAAAGTTA*.sup.(57) TTCGGAGAGATGATTTTTGTC*.sup.(58) 11-8 GCCTTAGCTTTTTACACAA*.sup.(59) TTTTTGATTATATCTCGTTG.sup.(60) TTATTCTCGTTGTTTTCCTTA*.sup.(61 ) 11-9 CCATTAAATTGTCCATATCTA*.sup.(62) GACGTAGGTGAATAGTGAAGA.sup.(63) TCAAATTCCTCTAACACTCC*.sup.(64) 11-10 GAAGATAGTACCAAGCAAGTC.sup.(65) TGAGACTTTGGTTCCTAATAC*.sup.(66) AGTAACGAACATTCAGACCAG*.sup.(67 ) 11-11 GTCTTCACTATTCACCTACG*.sup.(68) CCCCCAAACTGACTACACAA.sup.(69) AGCATACCAAGTCTACTGAAT*.sup.(70 ) 12 ACTCTTTCAAACATTAGGTCA*.sup.(71) TTGGAGAGGCAGGTGGAT.sup.(72) CTATAGAGGGAGAACAGAT*.sup.(73) 13 TTTATGCTGATTTCTGTTGTAT.sup.(74) ATAAAACGGGAAGTGTTAACT*.sup.(75) CTGTGAGTTATTTGGTGCAT*.sup.(76) 14 GAATACAAAACAGTTACCAGA.sup.(77) CACCACCAAAGGGGGAAA*.sup.(78) AAATGAGGGTCTGCAACAAA*.sup.(79) 15 GTCCGACCAGAACTTGAG.sup.(80) AGCCATTTGTAGGATACTAG*.sup.(81) CTACTAGACGGGCGGAG*.sup.(82) 16 ATGTTTTTGTAGTGAAGATTCT.sup.(83) TAGTTCGAGAGACAGTTAAG*.sup.(84) CAGTTTTGGTTTGTTATAATTG*.sup.(8 5) 17 CAGAGAATAGTTGTAGTTGTT.sup.(86) AACCTTAACCCATACTGCC*.sup.(87) TTCAGTATCATCCTATGTGG*.sup.(88) 18 TTTTATTCTCAGTTATTCAGTG.sup.(89) GAAATTGAGCATCCTTAGTAA*.sup.(90) AATTCTAGAGTCACACTTCC*.sup.(91) 19 ATATTTTTAAGGCAGTTCTAGA.sup.(92) TTACACACACCAAAAAAGTCA*.sup.(93) TGAAAACTCTTTATGATATCTGT*.sup.( 94) 20 TGAATGTTATATATGTGACTTTT*.sup.(95) CTTGTTGCTATTCTTTGTCTA.sup.(96) CCCTAGATACTAAAAAATAAAG*.sup.(9 7) 21 CTTTTAGCAGTTATATAGTTTC.sup.(98) GCCAGAGAGTCTAAAACAG*.sup.(99) CTTTGGGTGTTTTATGCTTG*.sup.(100 ) 22 TTTGTTGTATTTGTCCTGTTTA.sup.(101) ATTTTGTTAGTAAGGTCATTTTT*.sup.(102) GTTCTGATTGCTTTTTATTCC*.sup.(10 3) 23 ATCACTTCTTCCATTGCATC*.sup.(104) CCGTGGCTGGTAAATCTG*.sup.(105) 24 CTGGTAGCTCCAACTAATC*.sup.(106) ACCGGTACAAACCTTTCATTG*.sup.(107) 25 CTATTTTGATTTGCTTTTATTATT*.sup.(108) GCTATTTCCTTGATACTGGAC*.sup.(109) 26 TTGGAAACATAAATATGTGGG*.sup.(110) ACTTACAGGAGCCACATAAC*.sup.(111) 27 CTACATTAATTATGATAGGCTNCG**.sup.(112) GTACTAATGTGTGGTTTGAAA**.sup.(113) TCAATGCAAGTTCTTCGTCAGC*.sup.(114) __________________________________________________________________________ Primers with an “*” were used for sequencing. Primers without an “*” were replaced by the internal nested primer for both the second round of PCR and sequencing. For large exons requiring internal sequencing primers, primers with an “**” were used to amplify the exon Number in parathensis referes to the SEQ ID NO: for each primer.

EXAMPLE 4

Identification of BRCA2

Assembly of the full-length BRCA2 sequence. The full-length sequence of BRCA2 was assembled by combination of several smaller sequences obtained from hybrid selection, exon trapping, cDNA library screening, genomic sequencing, and PCR experiments using cDNA as template for amplification (i.e., “island hopping”) (FIG. 2). The extreme 5′ end of the mRNA including the predicted translational start site was identified by a modified 5′RACE protocol (Stone et al., 1995). The first nucleotide in the sequence (nucleotide 1) is a non-template G, an indication that the mRNA cap is contained in the sequence. One of the exons (exon 11) located on the interior of the BRCA2 cDNA is nearly 5 kb. A portion of exon 11 was identified by analysis of roughly 900 kb of genomic sequence in the public domain (ftp://genome.wust1.edu/pub/gscl/brca). This genomic sequence was condensed with genomic sequence determined by us into a set of 160 sequence contigs. When the condensed genomic sequence was scanned for open reading frames (ORFs), a contiguous stretch of nearly 5 kb was identified that was spanned by long ORFs. This sequence was linked together by island hopping experiments with two previously identified candidate gene fragments. The current composite BRCA2 cDNA sequence consists of 11,385 bp, but does not include the polyadenylation signal or poly(A) tail. This cDNA sequence is set forth in SEQ ID NO:1 and FIG. 3.

Structure of the BRCA2 gene and BRCA2 polypeptide. Conceptual translation of the cDNA revealed an ORF that began at nucleotide 229 and encoded a predicted protein of 3418 amino acids. The peptide bears no discernible similarity to other proteins apart from sequence composition. There is no signal sequence at the amino terminus, and no obvious membrane-spanning regions. Like BRCA1, the BRCA2 protein is highly charged. Roughly one quarter of the residues are acidic or basic.

The BRCA2 gene structure was determined by comparison of cDNA and genomic sequences. BRCA2 is composed of 27 exons distributed over roughly 70 kb of genomic DNA.

A CpG-rich region at the 5′ end of BRCA2 extending upstream suggests the presence of regulatory signals often associated with CpG “islands.” Based on Southern blot experiments, BRCA2 appears to be unique, with no close homologs in the human genome.

Expression studies of BRCA2. Hybridization of labeled cDNA to human multiple tissue Northern filters revealed an 11-12 kb transcript that was detectable in testis only. The size of the this transcript suggests that little of the BRCA2 mRNA sequence is missing from our composite cDNA. Because the Northern filters did not include mammary gland RNA, RT-PCR experiments using a BRCA2 cDNA amplicon were performed on five breast and three prostate cancer cell line RNAs. All of the lines produced positive signals. In addition, PCR of a BRCA2 amplicon (1-BrCGO26.fwdarw.5kb) and 5′ RACE were used to compare mammary gland and thymus cDNA as templates for amplification. In both cases, the product amplified more efficiently from breast than from thymus.

Germline mutations in BRCA2. Individuals from eighteen putative BRCA2 kindreds were screened for BRCA2 germline mutations by DNA sequence analysis (Wooster et al., 1994). Twelve kindreds have at least one case of male breast cancer, four have two or more cases; and, four include at least one individual affected with ovarian cancer who shares the linked BRCA2 haplotype. Each of the 18 kindreds has a posterior probability of harboring a BRCA2 mutation of at least 69%, and nine kindreds have posterior probabilities greater than 90%. Based on these combined probabilities, 16 of 18 kindreds are expected to segregate BRCA2 mutations. The entire coding sequence and associated splice junctions were screened for mutations in multiple individuals from nine kindreds using either cDNA or genomic DNA (Table 3). Individuals from the remaining nine kindreds were screened for mutations using only genomic DNA. These latter screening experiments encompassed 99% of the coding sequence (all exons excluding exon 15) and all but two of the splice junctions.

TABLE 3 __________________________________________________________________________ Set of Families Screened for BRCA2 Mutations FBC Prior BRCA2 Family FBC <50 yrs Ov MBC LOD Probability Mutation Exon Codon Effect __________________________________________________________________________ UT-107.sup.1 20 18 2 3 5.06 1.00 277 delAC 2 17 termination codon at 29 UT-1018.sup.1 11 9 0 1 2.47 1.00 982 del4 9 252 termination codon at 275 UT-2044.sup.1 8 6 4 1 2.13 1.00 4706 del4 11 1493 termination codon at 1502 UT-2367.sup.1 6 5 1 0 2.09 0.99 IR UT-2327.sup.1 13 6 0 0 1.92 0.99 ND UT-2388.sup.1 3 3 1 0 0.92 0.92 ND UT-2328.sup.1 10 4 0 1 0.21 0.87 ND UT-4328.sup.1 4 3 0 0 0.18 0.69 ND MI-1016.sup.1 4 2 0 1 0.04 0.81 ND CU-20.sup.2 4 3 2 2 1.09 1.00 8525 delC 18 2766 termination codon at 2776 CU-159.sup.2 8 4 0 0 0.99 0.94 9254 del 5 23 3009 termination codon at 3015 UT-2043.sup.2 2 2 1 1 0.86 0.97 4075 delGT 11 1283 termination codon at 1285 IC-2204.sup.2 3 1 0 4 0.51 0.98 999 del5 9 257 termination codon at 273 MS-075.sup.2 4 1 0 1 0.50 0.93 6174 delT 11 1982 termination codon at 2003 UT-1019.sup.2 5 1 0 2 nd 0.95 4132 del3 11 1302 deletion of thr.sub.1302 UT-2027.sup.2 4 4 0 1 0.39 0.79 ND UT-2263.sup.2 3 2 0 1 nd 0.9 ND UT-2171.sup.2 5 4 2 0 nd nd ND __________________________________________________________________________ .sup.1 Families screened for complete coding sequence and with informativ cDNA sample. .sup.2 Families screened for all BRCA2 exons except 15 and for which ther was no informative cDNA sample available. IR -- inferred regulatory mutuation ND -- non detected nd -- not determined FBC -- Female Breast Cancer Ov -- Ovarian Cancer MBC -- Male Breast Cancer

Sequence alterations were identified in 9 of 18 kindreds. All except one involved nucleotide deletions that altered the reading frame, leading to truncation of the predicted BRCA2 protein. The single exception contained a deletion of three nucleotides (kindred 1019). All nine mutations differed from one another. A subset of kindreds was tested for transcript loss. cDNA samples were available for a group of nine kindreds, but three of the nine kindreds in the group contained frameshift mutations. Specific polymorphic sites know to be heterozygous in genomic DNA were examined in cDNA from kindred individuals. The appearance of hemizygosity at these polymorphic sites was interpreted as evidence for a mutation leading to reduction in mRNA levels. In only one of the six cases with no detectable sequence alteration (kindred 2367) could such a regulatory mutation be inferred. In addition, one of the three kindreds with a frameshift mutation (kindred 2044) displayed signs of transcript loss. This implies that some mutations in the BRCA2 coding sequence may destabilize the transcript in addition to disrupting the protein sequence. Such mutations have been observed in BRCA1 (Friedman et al., 1995). Thus, 56% of the kindreds (10 of 18) contained an altered BRCA2 gene.

Role of BRCA2 in Cancer. Most tumor suppressor genes identified to date give rise to protein products that are absent, nonfunctional, or reduced in function. The majority of TP53 mutations are missense; some of these have been shown to produce abnormal p53 molecules that interfere with the function of the wildtype product (Shaulian et al., 1992; Srivastava et al., 1993). A similar dominant negative mechanism of action has been proposed for some adenomatous polyposis coli (APC) alleles that produce truncated molecules (Su et al., 1993), and for point mutations in the Wilms' tumor gene (WT1) that alter DNA binding of the protein (Little et al., 1993). The nature of the mutations observed in the BRCA2 coding sequence is consistent with production of either dominant negative proteins or nonfunctional proteins.

EXAMPLE 5

Analysis of the BRCA2 Gene

The structure and function of BRCA2 gene are determined according to the following methods.

Biological Studies. Mammalian expression vectors containing BRCA2 cDNA are constructed and transfected into appropriate breast carcinoma cells with lesions in the gene. Wild-type BRCA2 cDNA as well as altered BRCA2 cDNA are utilized. The altered BRCA2 cDNA can be obtained from altered BRCA2 alleles or produced as described below. Phenotypic reversion in cultures (e.g., cell morphology, doubling time, anchorage-independent growth) and in animals (e.g., tumorigenicity) is examined. The studies will employ both wild-type and mutant forms (Section B) of the gene.

Molecular Genetics Studies. In vitro mutagenesis is performed to construct deletion mutants and missense mutants (by single base-pair substitutions in individual codons and cluster charged.fwdarw.alanine scanning mutagenesis). The mutants are used in biological, biochemical and biophysical studies.

Mechanism Studies. The ability of BRCA2 protein to bind to known and unknown DNA sequences is examined. Its ability to transactivate promoters is analyzed by transient reporter expression systems in mammalian cells. Conventional procedures such as particle-capture and yeast two-hybrid system are used to discover and identify any functional partners. The nature and functions of the partners are characterized. These partners in turn are targets for drug discovery.

Structural Studies. Recombinant proteins are produced in E. coli, yeast, insect and/or mammalian cells and are used in crystallographical and NMR studies. Molecular modeling of the proteins is also employed. These studies facilitate structure-driven drug design.

EXAMPLE 6

Two Step Assay to Detect the Presence of BRCA2 in a Sample

Patient sample is processed according to the method disclosed by Antonarakis et al. (1985), separated through a 1% agarose gel and transferred to nylon membrane for Southern blot analysis.

Membranes are UV cross linked at 150 mJ using a GS Gene Linker (Bio-Rad). A BRCA2 probe selected from the sequence shown in FIG. 3 is subcloned into pTZ18U. The phagemids are transformed into E. Coli MV 1190 infected with M13KO7 helper phage (Bio-Rad, Richmond, Calif.). Single stranded DNA is isolated according to standard procedures (see Sambrook et al., 1989).

Blots are prehybridized for 15-30 min at 65.degree. C. in 7% sodium dodecyl sulfate (SDS) in 0.5 M NaPO.sub.4. The methods follow those described by Nguyen et al., 1992. The blots are hybridized overnight at 65.degree. C. in 7% SDS, 0.5 M NaPO.sub.4 with 25-50 ng/ml single stranded probe DNA. Post-hybridization washes consist of two 30 min washes in 5% SDS, 40 mM NaPO.sub.4 at 65.degree. C., followed by two 30 min washes in 1% SDS, 40 mM NaPO.sub.4 at 65.degree. C.

Next the blots are rinsed with phosphate buffered saline (pH 6.8) for 5 min at room temperature and incubated with 0.2% casein in PBS for 30-60 min at room temperature and rinsed in PBS for 5 min. The blots are then preincubated for 5-10 minutes in a shaking water bath at 45.degree. C. with hybridization buffer consisting of 6 M urea, 0.3 M NaCl, and 5.times.Denhardt's solution (see Sambrook, et al., 1989). The buffer is removed and replaced with 50-75 .mu.l/cm.sup.2 fresh hybridization buffer plus 2.5 nM of the covalently cross-linked oligonucleotide-alkaline phosphatase conjugate with the nucleotide sequence complementary to the universal primer site (UP-AP, Bio-Rad). The blots are hybridized for 20-30 min at 45.degree. C. and post hybridization washes are incubated at 45.degree. C. as two 10 min washes in 6 M urea, 1.times.standard saline citrate (SSC), 0.1% SDS and one 10 min wash in 1.times.SSC, 0.1% Triton.RTM.X-100. The blots are rinsed for 10 min at room temperature with 1.times.SSC.

Blots are incubated for 10 min at room temperature with shaking in the substrate buffer consisting of 0.1 M diethanolamine, 1 mM MgCl.sub.2, 0.02% sodium azide, pH 10.0. Individual blots are placed in heat sealable bags with substrate buffer and 0.2 mM AMPPD (3-(2'-spiroadamantane)-4-methoxy-4-(3'-phosphoryloxy)phenyl-1,2-dioxetane , disodium salt, Bio-Rad).

After a 20 min incubation at room temperature with shaking, the excess AMPPD solution is removed. The blot is exposed to X-ray film overnight. Positive bands indicate the presence of BRCA2.

EXAMPLE 7

Generation of Polyclonal Antibody against BRCA2

Segments of BRCA2 coding sequence are expressed as fusion protein in E. coli. The overexpressed protein is purified by gel elution and used to immunize rabbits and mice using a procedure similar to the one described by Harlow and Lane, 1988. This procedure has been shown to generate Abs against various other proteins (for example, see Kraemer et al., 1993).

Briefly, a stretch of BRCA2 coding sequence selected from the sequence shown in FIG. 3 is cloned as a fusion protein in plasmid PET5A (Novagen, Inc., Madison, Wis.). After induction with IPTG, the overexpression of a fusion protein with the expected molecular weight is verified by SDS/PAGE. Fusion protein is purified from the gel by electroelution. The identification of the protein as the BRCA2 fusion product is verified by protein sequencing at the N-terminus. Next, the purified protein is used as immunogen in rabbits. Rabbits are immunized with 100 .mu.g of the protein in complete Freund's adjuvant and boosted twice in 3 week intervals, first with 100 .mu.g of immunogen in incomplete Freund's adjuvant followed by 100 .mu.g of immunogen in PBS. Antibody containing serum is collected two weeks thereafter.

This procedure is repeated to generate antibodies against the mutant forms of the BRCA2 gene. These antibodies, in conjunction with antibodies to wild type BRCA2, are used to detect the presence and the relative level of the mutant forms in various tissues and biological fluids.

EXAMPLE 8

Generation of Monoclonal Antibodies Specific for BRCA2

Monoclonal antibodies are generated according to the following protocol. Mice are immunized with immunogen comprising intact BRCA2 or BRCA2 peptides (wild type or mutant) conjugated to keyhole limpet hemocyanin using glutaraldehyde or EDC as is well known.

The immunogen is mixed with an adjuvant. Each mouse receives four injections of 10 to 100 .mu.g of immunogen and after the fourth injection blood samples are taken from the mice to determine if the serum contains antibody to the immunogen. Serum titer is determined by ELISA or RIA. Mice with sera indicating the presence of antibody to the immunogen are selected for hybridoma production.

Spleens are removed from immune mice and a single cell suspension is prepared (see Harlow and Lane, 1988). Cell fusions are performed essentially as described by Kohler and Milstein, 1975. Briefly, P3.65.3 myeloma cells (American Type Culture Collection, Rockville, Md.) are fused with immune spleen cells using polyethylene glycol as described by Harlow and Lane, 1988.

Cells are plated at a density of 2.times.10.sup.5 cells/well in 96 well tissue culture plates. Individual wells are examined for growth and the supernatants of wells with growth are tested for the presence of BRCA2 specific antibodies by ELISA or RIA using wild type or mutant BRCA2 target protein. Cells in positive wells are expanded and subcloned to establish and confirm monoclonality.

Clones with the desired specificities are expanded and grown as ascites in mice or in a hollow fiber system to produce sufficient quantities of antibody for characterization and assay development.

EXAMPLE 9

Sandwich Assay for BRCA2

Monoclonal antibody is attached to a solid surface such as a plate, tube, bead, or particle.

Preferably, the antibody is attached to the well surface of a 96-well ELISA plate. 100 .mu.l sample (e.g., serum, urine, tissue cytosol) containing the BRCA2 peptide/protein (wild-type or mutant) is added to the solid phase antibody. The sample is incubated for 2 hrs at room temperature. Next the sample fluid is decanted, and the solid phase is washed with buffer to remove unbound material. 100 .mu.l of a second monoclonal antibody (to a different determinant on the BRCA2 peptide/protein) is added to the solid phase. This antibody is labeled with a detector molecule (e.g., .sup.125 I, enzyme, fluorophore, or a chromophore) and the solid phase with the second antibody is incubated for two hrs at room temperature. The second antibody is decanted and the solid phase is washed with buffer to remove unbound material.

The amount of bound label, which is proportional to the amount of BRCA2 peptide/protein present in the sample, is quantitated. Separate assays are performed using monoclonal antibodies which are specific for the wild-type BRCA2 as well as monoclonal antibodies specific for each of the mutations identified in BRCA2.

EXAMPLE 10

The 6174delT Mutation is Common in Ashkenazi Jewish Women Affected by Breast Cancer

The 6174delT mutation (see Table 3) has been found to be present in many cases of Ashkenazi Jewish women who have had breast cancer (Neuhausen et al., 1996). Two groups of probands comprised the ascertainment for this study. The first group was ascertained based on both age-of-onset and a positive family history. The first group consisted of probands affected with breast cancer on or before 41 years of age with or without a family history of breast cancer. Inclusion criteria for the second group were that the proband was affected with breast cancer between the ages of 41 and 51 with one or more first degree relatives affected with breast or ovarian cancer on or before the age of 50; or the proband was affected with breast cancer between the ages of 41 and 51 with two or more second degree relatives affected with breast or ovarian cancer, 1 on or before age 50; or the proband was affected between the ages of 41 and 51 with both primary breast and primary ovarian cancer. Probands were ascertained through medical oncology and genetic counseling clinics, with an effort to offer study participation to all eligible patients. Family history was obtained by a self-report questionnaire. Histologic confirmation of diagnosis was obtained for probands in all cases. Religious background was confirmed on all probands by self report or interview.

Mutation Detection

The BRCA2 6174delT mutation was detected by amplifying genomic DNA from each patient according to standard polymerase chain reaction (PCR) procedures (Saiki et al., 1985; Mullis et al., 1986; Weber and May, 1989). The primers used for the PCR are:

(forward primer) and

(reverse primer).

The reactions were performed in a total volume of 10.0 .mu.l containing 20 .mu.g DNA with annealing at 55.degree. C. This produces a PCR product 97 bp long in wild-type samples and 96 bp long when the 6174delT mutation is present. The radiolabeled PCR products were electrophoresed on standard 6% polyacrylamide denaturing sequencing gels at 65 W for 2 hours. The gels were then dried and autoradiographed. All the cases exhibiting the 1 bp deletion were sequenced to confirm the 6174delT mutation. For sequencing, half of the samples were amplified with one set of PCR primers and the coding strand was sequenced and the other half of the samples were amplified with a second set of PCR primers and the noncoding strand was sequenced. For one set the PCR primers were:

(forward primer) and

(reverse primer).

This results in an amplified product of 342 bp in wild-type and 341 bp for samples containing the 6174delT mutation. For this set of samples the amplified DNA was sequenced using the CGORF-RH primer for the sequencing primer. The other half of the samples were amplified using the BC11 -RP forward primer and the CGORF-RH reverse primer resulting in a fragment of 183 bp in wild-type samples and 182 bp in samples containing the 6174delT mutation. This was sequenced using BC11-RP as the sequencing primer.

Results

Six out of eighty women of Ashkenazi Jewish ancestry with breast cancer before the age of 42 had the 6174delT mutation. This compares to zero cases of the mutation being present in a control group of non-Jewish women who had breast cancer before the age of 42. These cases were ascertained without regard to family history. Table 4 shows the results of the study. Four of the six cases with the 6174delT mutation had a family history of breast or ovarian cancer in a first or second degree relative. In each of two kindreds where multiple samples were available for analysis, the 6174delT mutation co-segregated with two or more cases of breast or ovarian cancer. A second cohort of 27 Ashkenazim with breast cancer at age 42-50 and a history of at least one additional relative affected with breast or ovarian cancer provided an additional estimate of the frequency of the 6174delT mutation. In this group of 27 women, two were heterozygous for the BRCA2 6174delT mutation. One of these individuals had first degree relatives with both ovarian and breast cancer. From the data presented, and assuming a penetrance similar to BRCA1 mutations (Offit et al., 1996; Langston et al., 1996), the frequency of the 6174delT mutation in Ashkenazim can be estimated to be approximately 3 per thousand. However, if the penetrance of this mutation is lower than BRCA1, then the frequency of this mutation will be higher. A more precise estimate of the carrier frequency of the 6174delT mutation in individuals of Ashkenazi Jewish ancestry will emerge from large-scale population studies.

TABLE 4 ______________________________________ Number of subjects Number with Group tested, n = 6174delT, n = % ______________________________________ Group 1a Diagnosis before age 93 0 (0) 42, Non-Jewish.sup.a Group 1b Diagnosis before age 80 6 (8) 42, Jewish.sup.a Before age 37 40 4 (10) age 37-41 40 2 (5) Group 2 Diagnosis ages 42-50 27 2 (27) and family history positive.sup.b ______________________________________ Key: .sup.a Ascertained regardless of family history .sup.b Family history for this group was defined as one first degree or two second degree relatives diagnosed with breast or ovarian cancer, one before age 50.

EXAMPLE 11

BRCA2 Shows a Low Somatic Mutation Rate in Breast Carcinoma and Other Cancers Including Ovarian and Pancreatic Cancers

BRCA2 is a tumor suppressor gene. A homozygous deletion of this gene may lead to breast cancer as well as other cancers. A homozygous deletion in a pancreatic xenograft was instrumental in the effort to isolate BRCA2 by positional cloning. Cancer may also result if there is a loss of one BRCA2 allele and a mutation in the remaining allele (loss of heterozygosity or LOH).

Mutations in both alleles may also lead to development of cancer. For studies here, an analysis of 150 cell lines derived from different cancers revealed no cases in which there was a homozygous loss of the BRCA2 gene. Because homozygous loss is apparently rare, investigations were made to study smaller lesions such as point mutations in BRCA2. Since compound mutant heterozygotes and mutant homozygotes are rare, tumor suppressor gene inactivation nearly always involves LOH. The remaining allele, if inactive, typically contains disruptive mutations. To identify these it is useful to preselect tumors or cell lines that exhibit LOH at the locus of interest.

Identification of tumors and cell lines that exhibit LOH

A group of 104 primary breast tumor samples and a set of 269 cell lines was tested for LOH in the BRCA2 region. For primary tumors, amplifications of three short tandem repeat markers (STRs) were compared quantitatively using fluorescence. Approximately 10 ng of genomic DNA was amplified by PCR with the following three sets of fluorescently tagged STRs:

(1) mM4247.4A.2F1 ACCATCAAACACATCATCC (SEQ ID NO: 119)

mM4247.4A.2R2 AGAAAGTAACTTGGAGGGAG (SEQ ID NO: 120)

(2) STR257-FC CTCCTGAAACTGTTCCCTTGG (SEQ ID NO: 121)

STR257-RD TAATGGTGCTGGGATATTTGG (SEQ ID NO: 122)

(3) mMB561A-3.1FA2 GAATGTCGAAGAGCTTGTC (SEQ ID NO: 123)

mMB561A-3.1RB AAACATACGCTTAGCCAGAC (SEQ ID NO: 124)

The PCR products were resolved using an ABI 377 sequencer and quantified with Genescan software (ABI). For tumors, clear peak height differences between alleles amplified from normal and tumor samples were scored as having LOH. For cell lines, if one STR was heterozygous, the sample was scored as non-LOH. In only one case was a cell line or tumor miscalled based on later analysis of single base polymorphisms. The heterozygosity indices for the markers are: STR4247 =0.89; STR257=0.72; STR561A=0.88 (S. Neuhausen, personal communication; B. Swedlund, unpublished data). Based on their combined heterozygosity indices, the chance that the markers are all homozygous in a particular individual (assuming linkage equilibrium) is only one in 250. Due to the presence of normal cells in the primary tumor sample, LOH seldom eliminates the signal entirely from the allele lost in the tumor. Rather, the relative intensities of the two alleles are altered. This can be seen clearly by comparing the allelic peak heights from normal tissue with peak heights from the tumor (FIGS. 5A-5D). Based on this analysis, 30 tumors (29%) were classified as having LOH at the BRCA2 locus (Table 5), a figure that is similar to previous estimates (Collins et al., 1995; Cleton-Jansen et al., 1995).

LOH was assessed in the set of cell lines in a different fashion. Since homozygosity of all three STRs was improbable, and since normal cells were not present, apparent homozygosity at all STRs was interpreted as LOH in the BRCA2 region. Using this criterion, 85/269 of the cell lines exhibited LOH (see Table 5). The frequencies varied according to the particular tumor cell type under consideration. For example, 4/6 ovarian cell lines and 31/62 lung cancer lines displayed LOH compared with 17/81 melanoma lines and 2/11 breast cancer lines.

Sequence Analysis of LOH Primary Breast Tumors and Cell Lines

The 30 primary breast cancers identified above which showed LOH in the BRCA2 region were screened by DNA sequence analysis for sequence variants. Greater than 95% of the coding sequence and splice junctions was examined. DNA sequencing was carried out either on the ABI 377 (Applied Biosystems Division, Perkin-Elmer) or manually. For the radioactive mutation screen, the amplified products were purified by Qiagen beads (Qiagen, Inc.). DNA sequence was generated using the Cyclist sequencing kit (Stratagene) and resolved on 6% polyacrylamide gels. In parallel, non-radioactive sequencing using fluorescent labeling dyes was performed using the TaqFS sequencing kit followed by electrophoresis on ABI 377 sequencers. Samples were gridded into 96-well trays to facilitate PCR and sequencing. Dropouts of particular PCR and sequencing reactions were repeated until>95% coverage was obtained for every sample. Sequence information was analyzed with the Sequencher software (Gene Codes Corporation). All detected mutations were confirmed by sequencing a newly amplified PCR product to exclude the possibility that the sequence alteration was due to a PCR artifact.

TABLE 5 ______________________________________ Type # LOH/# Screened Percentage LOH # Sequenced ______________________________________ Astrocytoma 6/19 32% 6 Bladder 6/17 35% 4 Breast 2/11 18% 2 Colon 2/8 25% 2 Glioma 11/36 31% 5 Lung 31/62 50% 20 Lymphoma 0/4 0% 0 Melanoma 17/81 21% 9 Neuroblastoma 1/10 10% 1 Ovarian 4/6 67% 4 Pancreatic 1/3 33% 1 Prostate 0/2 0% 0 Renal 4/10 40% 4 Total 85/269 33% (avg. = 28%) 58 Primary Breast 30/104 29% 42 ______________________________________

LOH analysis of cell lines and primary breast tumors. Percentage LOH was calculated two ways: as total and as a mean of percentages (avg.).

Of the 30 samples, two specimens contained frameshift mutations, one a nonsense mutation, and two contained missense changes (although one of these tumors also contained a frameshift). The nonsense mutation would delete 156 codons at the C-terminus suggesting that the C-terminal end of BRCA2 is important for tumor suppressor activity. All sequence variants were also present in the corresponding normal DNA from these cancer patients. To exclude the unlikely possibility that preselection for LOH introduced a systematic bias against detecting mutations (e.g., dominant behavior of mutations, compound heterozygotes), 12 samples shown to be heterozygous at BRCA2 were also screened. Three of these revealed missense changes that were also found in the normal samples. Thus, in a set of 42 breast carcinoma samples, 30 of which displayed LOH at the BRCA2 locus, no somatic mutations were identified. The frameshift and nonsense changes are likely to be predisposing mutations that influenced development of breast cancer in these patients. The missense variants are rare; they were each observed only once during analysis of 115 chromosomes. From these data it is not possible to distinguish between rare neutral polymorphisms and predisposing mutations.

Of the 85 cell lines which displayed LOH (see Table 5), 58 were also screened for sequence changes. Greater than 95% of the coding sequence of each sample was screened. Only a single frameshift mutation was identified by this DNA sequence analysis. This mutation (6174delT) was present in a pancreatic cancer line and it is identical to one found in the BT111 primary tumor sample and to a previously detected germline frameshift (Tavtigian et al., 1996). This suggests that this particular frameshift may be a relatively common germline BRCA2 mutation. In addition, a number of missense sequence variants were detected (Tables 6A and 6B).

Detection of a probable germline BRCA2 mutation in a pancreatic tumor cell line suggests that BRCA2 mutations may predispose to pancreatic cancer, a possibility that has not been explored thoroughly. This mutation also adds weight to the involvement of BRCA2 in sporadic pancreatic cancer, implied previously by the homozygous deletion observed in a pancreatic xenograft (Schutte et al., 1995). Because only three pancreatic cell lines were examined in our study, further investigation of BRCA2 mutations in pancreatic cancers is warranted.

TABLE 6A ______________________________________ Sample Type LOH Change Effect Germline ______________________________________ 4H5 Renal yes G451C Ala.fwdarw.Pro 4G1 Ovarian yes A1093C Asn.fwdarw.His 2F8 Lung yes G1291C Val.fwdarw.Leu BT110 Primary breast yes 1493delA Frameshift yes 4F8 Ovarian yes C2117T Thr.fwdarw.Ile BT163 Primary breast no A2411C Asp.fwdarw.Ala yes 1D6 Bladder no G4813A Gly.fwdarw.Arg BT333 Primary breast no T5868G Asn.fwdarw.Lys yes 2A2 Glioma yes C5972T Thr.fwdarw.Met 2I4 Lung yes C5972T Thr.fwdarw.Met BT111 Primary breast yes 6174delT Frameshift yes 4G3 Pancreatic yes 6174delT Frameshift 1B7 Astrocytoma yes C6328T Arg.fwdarw.Cys BT118 Primary breast no G7049T Gly.fwdarw.Val yes BT115 Primary breast yes G7491C Gln.fwdarw.His yes 3D5 Melanoma yes A9537G Ile.fwdarw.Met BT85 Primary breast yes A10204T Lys.fwdarw.Stop yes 1E4 Breast yes C10298G Thr.fwdarw.Arg BT110 Primary breast yes A10462G Ile.fwdarw.Val yes ______________________________________

Germline mutations identified in BRCA2. Listed are the mutation positions based on the Genbank entry of BRCA2 (Schutte et al., 1995).

TABLE 6B ______________________________________ Position Change Effect Frequency ______________________________________ 5′UTR(203) G/A — 0.32 (0.26) PM(1342) C/A His.fwdarw.Asn 0.32 (0.37) PM(2457) T/C silent 0.04 (0.05) PM(3199) A/G Asn.fwdarw.Asp 0.04 (0.08) PM(3624) A/G silent 0.35 PM(3668) A/G Asn.fwdarw.Ser 0 (0.15) PM(4035) T/C silent 0.24 (0.10) PM(7470) A/G silent 0.26 (0.15) 1593 A.fwdarw.G silent <0.01 4296 G.fwdarw.A silent <0.01 5691 A.fwdarw.G silent <0.01 6051 A.fwdarw.G silent <0.01 6828 T.fwdarw.C silent <0.01 6921 T.fwdarw.C silent <0.01 ______________________________________

Common polymorphisms and silent substitutions detected in BRCA2 by DNA sequencing. Since some rare silent variants may affect gene function (e.g., splicing (Richard and Beckmann, 1995)), these are not preceded by “PM”. The frequencies of polymorphisms shown involve the second of the nucleotide pair. Frequencies reported in a previous study are shown in parentheses (Tavtigian et al., 1996). Numbering is as in Table 6A.

Industrial Utility

As previously described above, the present invention provides materials and methods for use in testing BRCA2 alleles of an individual and an interpretation of the normal or predisposing nature of the alleles. Individuals at higher than normal risk might modify their lifestyles appropriately. In the case of BRCA2, the most significant non-genetic risk factor is the protective effect of an early, full term pregnancy. Therefore, women at risk could consider early childbearing or a therapy designed to simulate the hormonal effects of an early full-term pregnancy. Women at high risk would also strive for early detection and would be more highly motivated to learn and practice breast self examination. Such women would also be highly motivated to have regular mammograms, perhaps starting at an earlier age than the general population. Ovarian screening could also be undertaken at greater frequency. Diagnostic methods based on sequence analysis of the BRCA2 locus could also be applied to tumor detection and classification. Sequence analysis could be used to diagnose precursor lesions. With the evolution of the method and the accumulation of information about BRCA2 and other causative loci, it could become possible to separate cancers into benign and malignant.

Women with breast cancers may follow different surgical procedures if they are predisposed, and therefore likely to have additional cancers, than if they are not predisposed. Other therapies may be developed, using either peptides or small molecules (rational drug design). Peptides could be the missing gene product itself or a portion of the missing gene product. Alternatively, the therapeutic agent could be another molecule that mimics the deleterious gene’s function, either a peptide or a nonpeptidic molecule that seeks to counteract the deleterious effect of the inherited locus. The therapy could also be gene based, through introduction of a normal BRCA2 allele into individuals to make a protein which will counteract the effect of the deleterious allele. These gene therapies may take many forms and may be directed either toward preventing the tumor from forming, curing a cancer once it has occurred, or stopping a cancer from metastasizing.

It will be appreciated that the methods and compositions of the instant invention can be incorporated in the form of a variety of embodiments, only a few of which are disclosed herein. It will be apparent to the artisan that other embodiments exist and do not depart from the spirit of the invention. Thus, the described embodiments are illustrative and should not be construed as restrictive.

Comments (0)

Method of preventing colon cancer with vitamin D.sub.3 analogues

Filed under: Issued Patent — admin @ 12:08 am

Abstract
A method for preventing the initiation of colon cancer is disclosed. Vitamin D.sub.3 analogues prevented the development of adenomas and adenocarcinomas when administered to rats prior to, and subsequent to, chemically induced tumorigenesis.

——————————————————————————–
Inventors: Brasitus; Thomas A. (Olympia Fields, IL), Bissonnette; Bruce Marc (Chicago, IL), Sitrin; Michael D. (Flossmoor, IL)
Assignee: Arch Development Corporation (Chicago, IL)

Appl. No.: 08/418,638
Filed: April 7, 1995
Government Interests

——————————————————————————–

The government owns rights in the present invention pursuant to grant number CA36745, 5P30DK26678 from the Clinical Nutrition Research Unit, and P30DK42086 from the Digestive Diseases Research Core Center, DK39573 from the U.S. Public Health Science.
——————————————————————————–

Claims

——————————————————————————–

What is claimed is:

1. A method of reducing the incidence of colon malignant transformation in a subject comprising administering to the subject an effective amount of a non-calcemic analogue of Vitamin D.sub.3.

2. The method of claim 1, wherein said non-calcemic analogue of Vitamin D.sub.3 is selected from the group consisting of 26,26,26,27,27,27-hexafluoro-1.alpha.,25-dihydroxy-16-ene-23-yne-cholecalc iferol (RO24-5531), 26,26,26,27,27,27-hexafluoro-25-dihydroxy-16-ene-23-yne-cholecalciferol, 26,26,26,27,27,27-hexafluoro-1.alpha.-fluoro-25-hydroxy-16-ene-23-yne-chol ecalciferol, and 26,26,26,27,27,27-hexafluoro-1.alpha.,25-dihydroxy-16-ene-23-yne-19-nor-ch olecalciferol.

3. The method of claim 2, wherein said non-calcemic analogue of Vitamin D.sub.3 is 26,26,26,27,27,27-hexafluoro-1.alpha.,25-dihydroxy-16-ene-23-yne-cholecalc iferol (RO24-5531).

4. The method of claim 2, wherein said non-calcemic analogue of Vitamin D.sub.3 is 26,26,26,27,27,27-hexafluoro-25-dihydroxy-16-ene-23-yne-cholecalciferol.

5. The method of claim 2, wherein said non-calcemic analogue of Vitamin D.sub.3 is 26,26,26,27,27,27-hexafluoro-1.alpha.-fluoro-25-hydroxy-16-ene-23-yne-chol ecalciferol.

6. The method of claim 2, wherein said non-calcemic analogue of Vitamin D.sub.3 is 26,26,26,27,27,27-hexafluoro-1.alpha.,25-dihydroxy-16-ene-23-yne-19-nor-ch olecalciferol.

7. The method of claim 1, wherein said administering is oral administration.

8. The method of claim 1, wherein said administering is subcutaneous injection.

9. A method of preventing the development of adenocarcinomas in colon tissues by administering a composition, comprising a non-calcemic analogue of Vitamin D.sub.3.

10. The method of claim 9, wherein said administering is prior to the development of adenocarcinomas.

11. The method of claim 9, wherein said administering is subsequent to the development of adenocarcinomas.

12. The method of claim 9, wherein said development of adenocarcinomas in colon tissues is chemically induced.

13. The method of claim 12, wherein said development of adenocarcinomas in colon tissues is chemically induced by AOM or DMH.
——————————————————————————–

Description

——————————————————————————–

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates generally to the field of cancer prevention. In particular, the invention relates to a method of preventing colon cancer by vitamin D.sub.3 analogues. In one example, administration of 1.alpha., 25-Dihydroxy-16-ene-23-yne-26, 27-hexafluorocholecalciferol reduced the incidence of colon cancer in rats.

2. Description of the Related Art

Colon cancer is a leading cause of death among patients with internal malignancies in the United States and, unfortunately, at the time of initial diagnosis is incurable in approximately one-half of the patients found to harbor this malignancy (Zarling and Rhodes, Int. Med. Specialist 3:72-86, 1982). Moreover, despite advances in the fields of surgery, radiotherapy and chemotherapy, the cure rate for this disease has not improved significantly (Zarling and Rhodes, 1982). Based on these considerations, the search for strategies to prevent the development of cancers in this organ has markedly intensified during the past decade.

Although the cause of large bowel cancer is not known, most epidemiologists associate it with diet, and, in particular, the low-fiber, high-protein, high-fat content that characterizes the diet of most Americans and people in other urban, industrialized societies. Many observers believe that colon cancer is the first major cancer type for which available evidence is sufficient to recommend dietary changes in the general public (Willett, Nature 338:384, 1989; Greenwald, Cancer 70 (Suppl.): 1206, 1992). In this regard, the possibility of using dietary supplements as a strategy to prevent colon cancer has recently been recognized (Mukhtar and Athar, Clev. Clin. J. Med. 55:507-508, 1988).

During the past few years one such potential dietary supplement, vitamin D.sub.3, has received increasing attention. Data has accumulated from a number of different sources in support of the possibility that vitamin D.sub.3, or its metabolites, may play a preventive role in the development of colon cancer. Several epidemiological studies (Garland et al., Lancer 1:307-309, 1985; Garland et al., Int. J. Epidemiol. 9:227-231, 1980; Garland et al., Lancet II:1176-1178, 1989, Garland et al., Am J. Clin. Nutr. 54:193S-201S, 1991), for example, have suggested that vitamin D.sub.3 derived from the diet or from cutaneous synthesis due to sunlight exposure may decrease the risk of colon cancer in humans. Additionally, vitamin D.sub.3 dietary supplementation has been shown to inhibit the incidence of colon carcinogenesis induced by the administration of 1,2-dimethylhydrazine (DMH) in rats fed a high fat diet (Pence and Buddingh, Carcinogenesis (Lond) 9:187-190, 1988).

Both the vitamin D.sub.3 metabolites, 1.alpha.-hydroxyvitamin D.sub.3 (1.alpha.(OH)D.sub.3) (Kawaura et al., Carcinogenesis (Lond) 10:647-649, 1989, Kawaura et al., Cancer Lett. 55:149-152, 1990) and 1.alpha.,25-dihydroxyvitamin D.sub.3 (1.alpha.,25(OH).sub.2 D.sub.3) (Belli et al., Carcinogenesis 13:2293-2298, 1992), have also recently been shown to protect against the development of chemically-induced colonic tumors. Furthermore, 1.alpha.,25(OH).sub.2 D.sub.3 has been demonstrated to inhibit the proliferation of a number of malignant cell lines in vitro (Colson et al., Endocrinology 108:1083-1086, 1981, Lointier et al., Anticancer Res. 7:817-822, 1987, Niendorf, et al., J. Steroid Biochem. 27:815-828, 1987, Tanaka et al., Arch. Biochem. Biophys. 276:415-423, 1990, Halline et al., Endocrinology 134:1710-1717, 1994), including several derived from human colon adenocarcinomas (Lointier et al., 1987, Niendorf et al., 1987, Tanaka et al., 1990, Halline et al., 1994).

While these studies have suggested that vitamin D.sub.3 or one or more of its metabolites may prevent colon cancer, there is considerable concern about their potential toxicity, particularly with respect to elevation of serum Ca.sup.2+ levels and its consequences, such as deposition of this mineral in soft tissues (Kawaura, et al., 1989, Belli, et al., 1992, Anzano, et al., Cancer Res. 54:1653-1656, 1994).

Recently, a fluorinated derivative of vitamin D.sub.3, 1.alpha.,25(OH).sub.2 -16-ene-23-yne-26,27 F.sub.6 -vitamin D.sub.3 (RO24-5531), was found to inhibit proliferation of HL-60 cells (Zhou et al., Blood 78:15-82, 1991), presumably because substitution of fluorine atoms on C-26 and C-27 inhibits its metabolism and prolongs its actions (Anzano et al., 1994; Zhou et al., 1991). Moreover, RO24-5531 extended breast tumor latency and lessened tumor incidence as well as tumor number, without causing elevated levels of serum Ca.sup.2+ in these animals (Anzano et al., 1994).

In comparing breast and colon cancers, however, epidemiologic differences appear when various risk groups are studied. For example, in the United States, while Japanese immigrants have colon cancer rates similar to the Caucasian population, breast cancer rates take several generations to approach those of the resident population (Hanai et al., Nat. Can. Inst. Monograph 62:3-7, 1982, Haenszel, 1982). In a related study, the rates of breast cancer among Seventh-Day Adventists were similar to those in the general population, but rates of colon cancer were about 40% lower (Phillips et al., J. Natl. Cancer Inst. 65:1097-1107, 1980). In case-controlled and prospective cohort studies of colon and breast cancer, research indicated that clear associations were found between fat or meat intake and colon cancer, but not breast cancer, in each pair of analyses (Phillips, Cancer Res. 35:3513-3522, 1975; Willett et al., New Engl J. Med. 316:22-28, 1987). The treatment methods for colon cancer, of which more than 99% are adenocarcinomas, are generally different from those used for breast cancer treatment. In summary, with respect to natural history, epidemiological studies and treatment strategies, breast and colon cancer are substantially different.

While epidemiologic evidence implicates diet as a major etiologic factor for colorectal cancer, there exists a great need for a dietary supplement or anticarcinogen to prevent the primary initiation of tumorigenesis, without causing toxicity.

SUMMARY OF THE INVENTION

It is an object of the present invention to overcome this problem by providing a method for reducing the incidence of colon cancer by administering a nutrient supplement. The method comprises administering to a subject an effective amount of a non-calcemic analogue of vitamin D.sub.3 prior to and subsequent to the initiation of tumorigenesis. The present studies demonstrate in a surprising and unexpected manner that dietary supplementation with one such analogue, 1.alpha.,25-dihydroxy-16-ene-23-yne-26,27-hexafluorocholecalciferol, can inhibit the development of colonic tumors in mammals. Moreover, this synthetic analogue of 1.alpha.,25(OH).sub.2 D.sub.3 appears to be well-tolerated by the animals, and does not induce hypercalcemia or alterations in the serum levels of phosphorus, 25(OH)D.sub.3, or 1,25(OH)2D.sub.3.

MULTISTEP CARCINOGENESIS

Colon malignant transformation is a multistep event. It is thought to evolve through a series of genetic (Fearon and Vogelstein, Cell 61:759, 1990) and histopathologic forms. It begins with dysplastic areas of the forming in the colonic epithelium, which pass through a stage of adenomatous polyps, and ultimately progress to frank carcinoma (FIG. 1).

The first step towards colon carcinogenesis is thought to be the transformation of normal epithelial cells to hyperproliferative epithelial cells. This is represented by abnormal multiplication of epithelial cells or an increase in number of normal epithelial cells in normal arrangement, which is then followed by adenoma. Adenomas are characterized by dysplastic changes, particularly in the cell nucleus, that are frequently associated with metaplasia and carcinoma in situ. The underlying basement membrane or basal cell lamina, however, is not interrupted; that is, preneoplasia shows no evidence of microinvasion or other hallmarks of cancer behavior (Robbins et al., Neoplasia. Pathologic Basis of Disease, 1984). The morphological changes suggest that the preneoplastic cell is in transition from a normal to a neoplastic form.

A patient with adenoma may be classified as having early, intermediate or late adenoma depending upon the size and histological features of the adenomatous polyps, including the extent of dysplasia the adenomas possess. Patients with early to intermediate adenoma tend to have adenomatous polyps that are of a small size, sessile tubular in shape, and that are associated with mild dysplasia. While patients with intermediate to late adenoma will have more adenomatous polyps of a larger size, greater than 2 cm, tubovillous or villous in shape, with severe dysplasia. Although preneoplastic lesions may progress to neoplasia, they may also remain stable for long periods and may even regress, particularly if the initiating agent is removed.

Adenocarcinomas, are adenomas that have undergone the final step to neoplasia. This event is monoclonal, in that a single cell from either normal or preneoplastic tissue becomes neoplastic, with the expansion of that clone ultimately producing cancer (Fialkow et al., Genetics of Human Cancer, 1977). Microinvasion of the basement membrane characterizes the transition from preneoplasia (adenoma) to cancer (adenocarcinoma). The final step in colon malignant transformation is the release of tumor cells from the primary tumor into the blood where the dissemination of metastasis occurs, which is the major cause of death from cancer.

Each step, described herein, represents an increase in the incidence of colon malignant transformation. According to the present invention, the phrase “reducing the incidence of colon malignant transformation” is intended to refer to the cessation, or reduction in number, of any one of the steps involved in this progressive process towards cancer.

In one embodiment, reducing the incidence of colon malignant transformation may involve preventing any normal epithelial cells from transforming into hyperproliferative epithelial cells, or it may involve reducing the number of cells transforming into hyperproliferative epithelial cells. In another embodiment, reducing the incidence of colon malignant transformation may involve preventing any hyperproliferative epithelial cells from transforming into early adenomas, or it may involve reducing the number of cells transforming into early adenomas. In another embodiment, reducing the incidence of colon malignant transformation may involve preventing early adenomas from transforming into intermediate adenomas, or it may involve reducing the number of cells transforming into intermediate adenomas.

In yet another embodiment of the invention, reducing the incidence of colon malignant transformation may involve preventing any intermediate adenomas from transforming into late adenomas, or it may involve reducing the number of cells transforming into late adenomas. In a further embodiment, reducing the incidence of colon malignant transformation may involve preventing late adenomas from transforming into carcinoma or it may involve reducing the number of cells transforming into carcinoma. Finally, in another embodiment, reducing the incidence of colon malignant transformation may involve preventing any carcinoma from transforming into metastases, or it may involve reducing the number of cells transforming into metastases.

CANCER PREVENTION

For the purposes of the present invention, carcinogens may be divided into “initiators” and “promoters” (see FIG. 1; Byar, Recent Results in Cancer Research. Cancer Clinical Trials: A Critical Appraisal, 111:35-48, 1988). Certain agents appear to initiate cancer, while those designated as promoters are effective only after cancer has been initiated with some other agent. Some agents may act as both initiators and promoters. It is assumed that some of these initiated and promoted cells will then develop into precancerous lesions.

Adenocarcinoma designates the point at which pathologists would no longer designate lesions as preneoplastic, but would actually diagnose cancer. Prevention of the development of adenocarcinomas can, therefore, take place anywhere alon