|
Cancer Patent Abstract
The present invention concerns the use of inhibitors for the treatment
and/or prophylaxis of diseases which are the consequence of increased
receptor tyrosine kinase activity, particularly cancer. The use
is particularly directed towards inhibition or lowering of the overexpression
and/or altered activity of receptor tyrosine kinases (RTKs). In
particular, this altered activity of receptor tyrosine kinase can
be triggered by a mutation of FGFR-4, wherein this mutation is in
particular a point mutation in the transmembrane domain of FGFR-4
and leads to an exchange of a hydrophobic amino acid for a hydrophilic
amino acid. The invention further concerns the use of an inhibitor
directed against FGFR-4, for the treatment and/or prophylaxis of
cancer. Furthermore, the invention concerns a mutated FGFR-4, which
leads to overexpression and/or altered activity in cells. Finally,
the invention concerns a DNA and RNA sequence of a mutated FGFR-4
molecule. Finally, in addition the invention concerns a pharmaceutical
composition, containing the inhibitor as described above and further
a diagnostic and screening procedure.
Cancer Patent Claims
The invention claimed is:
1. An isolated or purified mutated human fibroblast growth factor
receptor-4 (FGFR-4), which comprises the amino acid sequence of
SEQ ID NO: 9, except that the glycine at position 388 of SEQ ID
NO: 9 has been substituted with arginine.
2. An isolated DNA molecule encoding the mutated human FGFR-4 of
claim 1.
3. An isolated RNA molecule encoding the mutated human FGFR-4 of
claim 1.
Cancer Patent Description
INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY FILED
Incorporated by reference in its entirety herein is a computer-readable
nucleotide/amino acid sequence listing submitted concurrently herewith
and identified as follows: One 9,558 Byte ASCII (Text) file named
"228167.sub.--ST25.sub.--2, " created on Apr. 26, 2007.
The present invention concerns the use of inhibitors for the treatment
and/or prophylaxis of diseases which are the consequence of increased
receptor tyrosine kinase activity, particularly cancer. The use
is particularly directed towards inhibition or lowering of the overexpression
and/or altered activity of receptor tyrosine kinases (RTKs). In
particular, this altered activity of receptor tyrosine kinase can
be triggered by a mutation of FGFR-4, wherein this mutation is in
particular a point mutation in the transmembrane domain of FGFR-4
and leads to the exchange of a hydrophobic amino acid for a hydrophilic
amino acid. The invention further concerns the use of the inhibitors
of FGFR kinases, particularly for the treatment and/or prophylaxis
of cancer. Furthermore, the invention concerns a mutated FGFR-4,
which leads to overexpression and/or altered activity in cells.
Finally, the invention concerns a DNA and RNA sequence of a mutated
FGFR-4 molecule. Finally, in addition the invention concerns a pharmaceutical
composition, containing the inhibitor as described above and, further,
a diagnostic and screening procedure.
Cell growth is a carefully regulated process dependent on the specific
needs of an organism. In a young organism, the cell division rate
exceeds the cell death rate, which leads to an increase in the size
of the organism. In an adult organism, the new formation of cells
and cell death are balanced so that a "steady state" arises.
In rare cases, however, the control of cell multiplication breaks
down and the cells begin to grow and to divide, although no specific
need for a higher number of cells of this type exists in the organism.
This uncontrolled cell growth is the cause of cancer. Factors that
can provoke the uncontrolled cell growth, sometimes associated with
metastasis formation, are often of a chemical nature, but can also
be of a physical nature, such as for example radioactive radiation.
Another cause of the triggering of cancer are genetic peculiarities
or mutations in a certain organism, which sooner or later lead to
the cells degenerating.
Up to now, it has still not been possible satisfactorily to elucidate
the processes which control normal growth and differentiation, for
example in the breast. In addition to hormonal control, there is
also a complex network of different, locally generated growth factors
which intervene in the development of the mammary cells. The precise
causes of the occurrence of cancer in mammary cells are as unclear
and unknown as they are diverse, as is also the case with other
cells. Alterations in oncogenes and tumour suppressor genes appear
to play an important part in breast cancer carcinogenesis. In addition,
reinforced stimulation by regulatory factors which arise in genetically
altered cells can lead to increased progression of cell growth.
At present, essentially two alternatives are available for the
treatment of cancer. Either the cancer cells are successfully removed
from the diseased organism completely by a surgical intervention,
or attempts are made to render the degenerated cells in the organism
harmless, for example by administration of medicaments (chemotherapy)
or by physical therapeutic procedures, such as irradiation.
In chemotherapy, medicaments are often used which in some form
intervene in the DNA metabolism and damage rapidly growing cells,
which have to produce higher DNA metabolic capacity, more strongly
than cells which are dividing slowly or not at all. However, a severe
disadvantage of many chemotherapeutic drugs is the low specificity
of the active substance used, as a result of which healthy cells
are also damaged during the chemotherapy. This low specificity of
the active substances further requires that their dosage must in
each case be such that as few as possible healthy cells are damaged,
with simultaneous killing of the cancer cells. This is often not
possible, and the cancer patient dies because of the ever further
spreading cancer cells, which in the final stages cause the failure
of vital functions.
It is assumed that the overexpression and/or altered activity of
certain growth factor receptors contribute to the intensified growth
of many neoplasms, including breast cancer. For example, the overexpression
of EGFR, i.e. epidermal factor receptor, or ERB B-2 receptor in
breast tumours has been linked with a poor prognosis. FGF (historically:
fibroblast growth factor) proteins could also be involved in the
development of cancer in breast glands or of other cancer; however
the results in this regard are contradictory or are inconclusive.
The FGFs constitute a large family of peptide regulatory factors,
of which 9 members are so far known. Eight of these have been well
characterised in man (Basilico and Moscatelli, 1992; Coulier et
al., 1993). The FGFs operate via high-affinity tyrosine kinase receptors,
which are coded for by at least four different genes. Further, the
FGFs are multifunctional regulatory peptides which could have an
effect not only on tumorigenesis but could also play a major part
in cardiovascular diseases, reconstruction after tissue injury,
neurobiology and embryonic development. The acidic and basic FGFs
(aFGF and bFGF) were the first and are the best characterised members
of the family. In vivo it could for example be shown that FGFs are
involved in mesodermal induction in embryogenesis (Slack et al.,
1987; Kimelman et al., 1988), and also involvement in angiogenesis
(Thomas et al., 1985; Thompson et al., 1989; Folkmann and Klagsbrun,
1987).
For the corresponding receptors (FGFRs), four similar genes coding
for them have been identified. These genes code for structurally
related proteins with an extracellular domain which consists of
three immunoglobulin loops and an acid portion, a hydrophobic transmembrane
domain and an intracellular domain, which incorporates a tyrosine
kinase activity. For two of these genes, FGFR-1 and FGFR-2, it could
be shown that they have multiple transcripts, which arise by alternative
splicing (Givol and Yayon, 1992 and Johnson and Williams, 1993).
Splice variants which arise from these genes differ with respect
to the number of immunoglobulin-like domains in the extracellular
region of the receptor and in the sequence for the second half of
the third immunoglobulin domain, which can arise from alternative
exons. In addition, transmembrane and juxtamembrane shortenings
or deletions can arise, which can generate secreted or kinase-inactive
protein products.
For FGFR-3, it was possible to find alternative transcripts and
corresponding isoforms, but for FGFR-4 there is only a single known
protein product. Because of the large number of FGFR genes and transcripts
and the lack in many protein products of a specificity for defined
FGFs, it is difficult to determine the action of a specific ligand
on a specific receptor. Hence, correlations between specific FGF
receptors and defined diseases can only be established with great
difficulty, let alone a correlation of a particular mechanism of
action of a defined receptor with a disease. Accordingly, it is
difficult effectively to treat diseases, especially the complex
disease picture cancer, utilising the FGFRs.
Hence it is an objection of the present invention to specify a
possible treatment and/or prophyl-axis of somatic disorders, in
the development of which receptor tyrosine kinases (RTKs) are involved,
particularly cancer. In particular, it is an objection of the present
invention to inhibit and/or to lower overexpression and/or altered,
for example constitutive activity of receptor tyrosine kinases.
It is further an objection of the present invention to inhibit
and/or to lower the altered activity of the receptor tyrosine kinase
of a mutated FGFR-4.
It is a further an objection of the present invention to specify
a further RTK which is involved in carcinogenesis and/or metastasis
formation. Further, it is an objection of the present invention
to specify a DNA sequence or corresponding RNA sequence of the RTK.
It is a further an objection of the present invention to specify
improved diagnostic or differential diagnostic and screening procedures.
Finally it is an objection of the present invention to specify
a pharmaceutical composition, with which in particular cancer can
be treated.
These objections are achieved by the objects of the independent
claims. The dependent claims specify preferred developments of the
invention.
For the better understanding of the present invention, the terms
used herein are explained in more detail.
By "inhibitor" is understood any substance which inhibits
the RTK or lowers their activity. This can be a low-molecular weight
substance directed against the RTK, a kinase-inactive receptor or
an anti-receptor antibody.
By "kinase-inactive receptor" is understood any receptor
which no longer has any tyrosine kinase activity.
By "receptor tyrosine kinase" [sic] is understood any
receptor which has tyrosine kinase activity. The expression includes
growth factor receptors which have tyrosine kinase activity, and
also HER2 or the met-receptors.,
By "RTK-Hyperfunction" is understood overexpression (see
below) and/or altered activity (see below).
"Defective signal transfer activities" means that a mutated
receptor is no longer capable of converting an extracellular growth
signal or another signal into an intracellular signal, in the sense
that this defective signal generation no longer depends on the presence
of a ligand, for example the growth factor.
"Growth factor" means any mitogenic chemical, usually
a polypeptide, which inter alia is secreted by normal and/or transformed
mammalian cells, and which plays a significant part in the regulation
of cell growth, in particular in the stimulation of the proliferation
of the cells and the maintenance of their viability. The term "growth
factor" for example includes epidermal growth factor (EGF),
platelet-derived growth factor (PDGF) and nerve growth factor (NGF),
and also FGF, namely fibroblast growth factor.
By "mutated receptor tyrosine kinase" is understood a
receptor tyrosine kinase which by comparison with the wild type
receptor contains a structural alteration, so that the receptor
has a different, e.g. no longer regulable, tyrosine kinase activity
from the wild type receptor. One class of mutations leads to altered
activity of the RTK.
By "wild type growth factor receptor" or "wild type"
receptor is understood a naturally occurring growth factor receptor
or receptor that bears the non-mutated amino acid sequence. The
"wild type" corresponds to the receptor variant most commonly
occurring in the population.
By "extracellular domain" of the growth factor receptor
or receptor is understood the part of the receptor which normally
projects out of the cell into the extracellular surroundings. The
extracellular domain for example includes the part of the receptor
to which a growth factor or another molecule (ligand) binds.
By "transmembrane region", of the growth factor receptor
or receptor is understood the hydrophobic portion of the receptor,
which is normally located in the cell membrane of the cell which
expresses the receptor.
By "tyrosine kinase domain" or "cytoplasmic domain"
of the growth factor receptor or receptor is understood the portion
of the receptor which is normally situated inside the cell, and
brings about the transphosphorylation of tyrosine residues.
By "an effective quantity" is understood a quantity of
the composition according to the invention which can achieve the
desired therapeutic effect.
By "fibroblast growth factor (FGF)" is understood a mitogenic
polypeptide which influences the growth and other properties of
cells, inter alia of fibroblasts.
By "overexpression" is understood increased production
of RTK protein by a cell as compared to the wild type. This can
for example be triggered by gene amplification of the RTK gene and
lead to excessive, uncontrolled cell division activity.
By "altered activity" is understood permanent activity
of a signal transfer route mediated by growth factor receptors.
Thus with an altered RTK the kinase activity is also present when
no ligand is present.
According to the present invention, it could be shown that a mutated
FGFR-4 can lead to overexpression and/or altered activity of the
corresponding receptor tyrosine kinase in cells and hence lead to
cancer.
Growth factor receptors play a decisive part in the development
and multiplication of human cancer cells. In healthy cells, the
growth factor receptors are inter alia involved in the control of
cell growth, but also in differentiation, cell migration, etc. The
actual signal for the cell division is the growth factor, which
is formed depending on the needs of the organism. The receptor undertakes
the function of signal transfer, i.e. it is involved in the conversion
of the extracellular growth signal into cell division activity in
the inside of the cell. With many growth factor receptors, their
ability; after binding of the growth factor to the extracellular
domain, to transfer phosphate residues onto tyrosine residues in
proteins plays a decisive part. These receptors are also described
as receptor tyrosine kinases. A review of receptor tyrosine kinases
is to be found in Yarden Y and Ullrich A, Rev. Biochem. 1988, 57,
443-78. The dimerisation of these growth factor receptors after
binding of the growth factor is a further important event in the
process of signal transfer. The conversion of an extracellular signal
into an intracellular signal mediated by growth factor receptors
with tyrosine kinase activity can be broken down into the following
five steps: 1. The binding of the growth factor (also described
as ligand) to the extracellular domain of the receptor induces a
conformational change; this causes 2. dimerisation of receptors
with altered conformation; with 3. simultaneous induction of kinase
activity; 4. transphosphorylation of tyrosine residues in the receptor
dimer, which once again creates and stabilises an activated receptor
conformation; and 5. phosphorylation of polypeptide substrates and
interaction with cellular factors.
Uncontrolled hyperfunction of this signal transfer chain for example
because of the overexpression or altered activity of the receptor
can inter alia lead to increased division activity of the relevant
cells and in the extreme case to a degenerated cancer cell. A review
concern-eing growth factor receptors and their function in signal
transfer from the extracellular to the intracellular milieu, and
the possible influence of abnormally expressed receptors on carcinogenesis,
is given in Ullrich A and Schlessinger J (1990) Cell 61, 203-212.
It has now surprisingly been found that in the five-stage signal
transfer chain explained above, a mutated FGFR-4 results in increased
signal transfer activity, in the development of which the altered
activity of mutated RTK is decisively involved.
Hence according to claim 1 of the present invention at least one
inhibitor of a receptor tyrosine kinase is used for the treatment
and/or prophylaxis of RTK-hyperfunction-induced disorders, particularly
cancer. Furthermore, according to the invention diseases or somatic
disorders which are the consequence of a hyperproliferation of tissues
and/or increased invasivity of tissues attributable to increased
signal transfer can also be eliminated or alleviated.
As inhibitor, as well as low-molecular weight substances, for example
at least one kinase-inactive receptor can be used. Through the use
of the inhibitor, e.g. of the kinase-inactive receptor, the altered
activity of the receptor tyrosine kinase can be inhibited and/or
lowered. As has already previously been stated, the overexpression
and/or altered activity of growth factor receptors is an important
factor in the triggering or the progression of cancer. The overexpression
of EGFR or the Erb B-2 receptor in breast tumours has for example
been associated with a poor prognosis (see above). Hence inhibition
of this overexpression and/or altered activity is an important component
in the treatment and/or prophylaxis of cancer. FGFR-4 is tissue-specifically
switched off during embryogenesis. However, it is present in 30%
of breast cancer patients; it is not detectable in the tissue of
healthy subjects. The use of inhibitors for receptor tyrosine kinase
leads to a lowering or complete inhibition of the overexpression
and/or altered activity. Likewise, the use of kinase-inactive receptors
leads to a lowering and/or complete inhibition of the activity of
the receptor tyrosine kinases, since the kinase function of the
heterodimer is no longer capable of signal transfer. The action
of kinase-inactive receptors is based on the fact that non-functional
heterodimers are formed (dilution effect). A lack of signal transfer
leads to prevention of the transmission of the overexpressed and/or
altered active signal, as a result of which the signal is prevented
from conversion into a biological response of the cell. As a result,
through this inhibition of the receptor tyrosine kinase or through
these kinase-inactive receptors, it is possible effectively and
positively to intervene in the treatment and/or prophylaxis of cancer.
It has surprisingly been found that the FGFR-4 mutation also occurs
in the germ line of healthy persons. It is assumed that the germ
line mutation leads to a genetic predisposition, which renders the
persons concerned susceptible to the outbreak of various diseases.
In connection with carcinogenesis, it is assumed that the increase
expression of the mutated receptor in the tumour tissue is involved
in the carcinogenesis. The germ line mutation is further regarded
as a predisposition inter alia for the following diseases: arteriosclerosis,
leukaemia, lymphoma, hepatic cell carcinoma and cholangiocarcinoma.
Consequently, the present invention makes a further genetic marker
available, which is found to be extremely helpful in the diagnosis
and early recognition of various diseases and susceptibility to
these.
The present invention therefore also concerns a procedure for the
detection of a nucleic acid which codes for FGFR-4 in case material,
whereby in particular mutations of the receptor-coding nucleic acid
are detected. This can for example be effected by hybridisation
with oligonucleotide probes, which can specifically indicate the
presence or absence of a mutation, in particular a point mutation.
In this, for example a "mismatch" between mutated nucleic
acid and oligonucleotide is utilised such that if a "mismatch"
is present a hybridisation does not take place and hence there is
no signal. Alternatively, mutations can also be detected by amplification
of the nucleic acid with specific FGFR-4 PCR primers and subsequent
cleavage with suitable restriction endonucleases. If for example
a mutation affects the recognition sequence of a restriction endonuclease,
such that for example the mutated recognition sequence is no longer
recognised as a cleavage site by the restriction endonuclease, this
leads to a different restriction fragment than in the non-mutated
wild type. By means of the PCR, restriction fragments can be specifically
detected, so that in the stated case for example a larger restriction
fragment is present in the mutant compared to the wild type. Alternatively,
however, a mutation can also lead to the creation of a new restriction
cleavage site, as a result of which a "wild-type fragment"
after cleavage with the appropriate enzyme becomes smaller in the
mutant. The mutation in the transmembrane domain of FGFR-4, at position
388 of the sequence, as deposited in the EMBL Gene Bank/DDBJ under
X57205 (SEQ ID NO: 9), which leads to an exchange of Gly in the
wild type for Arg in the mutant, concerns the recognition sequence
GGWCC of the restriction endonuclease BstNl. As a result, two new
restriction fragments of 80 and 29 b.p. are formed, which can inter
alia be detected by restriction analysis.
According to the present invention, it could further be shown that
overexpression and in particular altered activity of the RTK leads
to increased invasivity, i.e. to intensified metastasis formation.
Since metastasis formation is one of the main problems of cancer,
this means that the inhibition or lowering of the overexpression
and/or altered activity will lead to an effective agent in the combating
of cancer, by which in particular metastasis formation is inhibited.
Possible inhibitors are for example described in Mohammadi et al.
(1997).
Preferably according to the invention an intervention is made into
an overexpression and/or altered activity of the receptor tyrosine
kinase, which is triggered by a mutation of FGFR-4. This mutation
can be one or several point mutations. In particular, the mutation/mutations
occur in the transmembrane domain of FGFR-4, as a result of which
in particular a hydrophobic amino acid is exchanged for a hydrophilic
amino acid.
It is already known that point mutations which have led to an exchange
of hydrophobic for hydrophilic amino acids in FGFR-3 are associated
with certain diseases. Thus-for example, an altered activity of
fibroblast growth factor receptor 3 due to a point mutation in the
transmembrane domain has been found in achondroplasia. Achondroplasia,
which is the most commonly occurring genetic form of dwarfism, is
an autosomal dominant disorder, which is essentially based on a
defect in the maturation process of certain bones. It could be shown
that achondroplasia is triggered by a Gly to Arg substitution in
the transmembrane domain of FGFR-3. It could further be shown that
that the Arg mutation in FGFR-3 activates the kinase function of
the dimeric receptor. The Arg point mutation also leads to a ligand-independent
stimulation of the tyrosine kinase activity of FGFR-3 itself and
to strongly increased altered levels of phosphotyrosine on the receptor.
These results suggest that the molecular basis of achondroplasia
is unregulated signal transfer by FGFR-3.
A further mutation in the transmembrane domain of FGFR-3 is an
exchange alanine for glutamine. This amino acid exchange leads to
another disease, namely to Crouzon's disease with acanthosis nigricans.
According to the present invention, it was established that mutations
in FGFR-4, especially point mutations in the transmembrane domain,
which lead to an exchange of a hydrophobic for a hydrophilic amino
acid, are involved in the triggering and poor prognosis for cancer,
on account of which inhibition of receptor tyrosine kinases or the
use of kinase-inactive receptors are suitable for the treatment
and/or prophylaxis of cancer, wherein the receptor tyrosine kinases
are overexpressed or active in an altered way owing to a mutation.
In particular, for the point mutation at position 388, which leads
to an exchange of glycine for arginine, it could be shown that as
a result of this the receptor tyrosine kinases become active in
an altered way, and this homo- and heterozygotically results in
signal transfer without ligand stimulation, as a result of which
in turn an uncontrollable growth of cells can be triggered. In the
worst case, this uncontrolled growth leads to cancer. The transmembrane
domain then has the sequence (ID No.1):
RYTDIILYASGSLALAVLLLLARLY,
while the non-mutated domain has the following sequence (ID No.2):
RYTDIILYASGSLALAVLLLLAGLY.
Without being bound to one theory, it is assumed that the activation
of the receptor tyrosine kinase which bears one of the aforesaid
point mutations and in particular the point mutation at position
388, which leads to an exchange of glycine for arginine, is based
on a stabilisation of the receptor in a dimeric conformation, which
occurs because of interactions through which changes in the transmembrane
domain were made possible. The intensified formation of a ligand-independent
dimer leads to increased receptor tyrosine kinase activity and cellular
transformation. Other possibilities for the effect of the point
mutations on the triggering of cancer may for example have a basis
in that the mutation acts on the signal transfer by FGFR-4, in that
the receptor migration through the membrane is prevented, the receptor
dimerisation with itself or with other FGFRs is disturbed, or in
that the tyrosine kinase activity of the receptor is affected.
According to the present invention, it could be shown that 56%
of patients from St Petersburg with breast tumours (study of biopsies)
carried the mutation position 388, which is linked with an exchange
of glycine for arginine. Of these, 45% were heterozygotic and 11%
homozygotic. This significantly high proportion suggests a link
between the point mutation at position 388 and the occurrence of
breast cancer.
In a further study, in which German patients with breast tumours
were studied, only 43% of the patient showed the point mutations
at position 388. From the study with normal tissues of cancer patients
and DNA from the tissue of normal individuals, it can be inferred
that the mutation is a germ line mutation.
Furthermore, genomic DNA and cDNA from cell lines was also studied,
in order to determine the proportion of point mutations at position
388. The cell lines studied derived from breast tumours, normal
breast epithelial cell lines as a comparison, squamous cell carcinoma,
glioblastomas, neuroblastomas and uterine cancer. With all cell
lines, except for the normal breast epithelial cell lines, a significant
percentage of the point mutation at position 388 in the FGFR-4 molecule
could be found. Hence the above-mentioned use of inhibitors or kinase-inactive
receptors is especially suitable for the treatment of carcinomas.
Here the treatment of neuroblastomas, uterine cancer and pancreatic
cancer, but also other types of cancer, seems especially promising.
Particularly preferred is the use of inhibitors which inhibit a
mutated FGFR-4, especially with the mutation Gly.fwdarw.Arg at position
388 in the transmembrane domain.
Further, the present invention concerns a mutated FGFR-4, which
leads to overexpression and/or altered activity of the receptor
in cells. Preferably, this mutated FGFR-4 is characterised in that
a hydrophobic amino acid in the wild type receptor has been exchanged
for a hydrophilic amino acid in the mutated receptor. Especially
preferred is a mutaton which is a point mutation and occurs in the
transmembrane domain. Still more preferably the point mutation occurs
at position 388, as a result of which preferably a glycine is replaced
by arginine.
Hitherto, it was assumed among experts that only one FGFR-4 occurs,
which is not mutated. Mutated FGFR-4 was unknown. It was therefore-surprising
that it could be shown according to the present invention that a
mutated FGFR-4 exists. In particular, according to the present invention
a connection between the mutations, in particular the point mutation
at position 388, and the occurrence of cancer could be demonstrated.
Furthermore, the germ line mutation in healthy persons has been
connected with the genetic predisposition for the occurrence inter
alia of arteriosclerosis.
The invention further concerns a DNA molecule containing a sequence
which codes for a mutated FGFR-4. The invention also includes an
RNA molecule, containing an RNA sequence which codes for a mutated
FGFR-4. The above sequences can be used for diagnosis of cancer.
In this, the sequences can specifically recognise the mutations
in the FGFR-4. The presence of the mutation in the FGFR-4 is linked
with a poor prognosis for the treatment of the cancer. The reason
for this could be aggressive growth behaviour of the corresponding
tumour.
Apart from this, the invention concerns a procedure for the differential
diagnosis of breast cancer, wherein the patient's nucleic acid is
brought into contact with one of the DNAs and/or RNAs described
above, so that a signal is obtained, which indicates the presence
and/or absence of mutated FGFR-4. Finally, the present invention
concerns a pharmaceutical composition, containing the inhibitor
or the kinase-inactive receptor, as described above. Apart from
this, the invention concerns a screening procedure for the identification
of inhibitors of tyrosine kinase activity, wherein the receptor
according to the invention is brought into contact with potential
inhibitors and the tyrosine kinase activity in the presence and/or
absence of the inhibitor is determined.
Further, the detection of the presence of a mutation can also be
performed by PCR and subsequent restriction enzyme cleavage, as
already described in more detail above.
Finally, other molecular biological diagnostic procedures are also
a possibility.
Further, the object of the invention is an antibody which specifically
reacts with a mutated FGFR-4 according to the invention. "Specific"
in the sense of the invention means that the antibody according
to the invention binds to the mutated, but not to the non-mutated,
receptor.
Below, the invention is described in detail by the figures and
examples.
Here:
FIG. 1 shows SDS PAGE of an immunoprecipitation of FGFR-4 (the
phosphorylated FGF receptor-4 is marked by an arrow),
FIG. 2 a polyacrylamide gel of the mutated FGFR-4,
FIG. 3 a sequence analysis of the transmembrane domain of FGFR-4,
FIG. 4 the correlation between the FGFR-4 mutation G388R and the
lymph node metastasis formation status (n=number of patients, p=P
value) and
FIG. 5 the correlation between the FGFR-4 mutation G388R and the
relapse-free survival time (n=number of patients, p=P value).
EXAMPLES
Cell Culture. The human cell lines MDA-MB-453, ZR 75-1, K562 and
SKBr3 were obtained from the ATCC. The individual supply sources
can be found in the table at the end. MDA-MB-453, K562 and ZR 75-1
were cultivated in RPMI (Gibco, Eggenstein) containing 10% foetal
calf serum (Sigma, Taufkirchen). SKBR3 was cultivated in McCoy's
5a (Gibco, Egenstein) containing 15% foetal calf serum. All cell
culture media contained penicillin/streptomycin (Sigma, Taufkirchen).
The cells were incubated at 37.degree. C. in a water-vapour saturated
atmosphere and 8% CO.sub.2.
Cloning of FGFR-4.sup.388Arg/wt. For preparation of RNA from K562
and MDA-MB-453 cells, 3.times.10.sup.7 cells were lysed with guanidinium
isothiocyanate and purified by ultracentrifigation in a CsCl gradient.
The cDNA synthesis was effected with reverse transcriptase (Boehringer,
Mannheim) and 10 pmol of "random oligonucleotides" in
each case, according to the manufacturer's instructions. 0.5 .mu.l
were used in a subsequent PCR reaction.
FGFR-4.sup.388Argand FGFR-4wt were amplified by the PCR reaction.
For this, the following primers were used: sense-GCTCAGAGGGCGGGCGGGGGTGCCGGCCG
[SEQ ID NO: 3]; anti-sense CCGCTCGAGTGCCTGCACAGCCTTGAGCCTTGC [SEQ
ID NO: 4]. For the PCR reaction, the following were used: 1.5 U/25
.mu.l Expand-Polymerase (Boehringer, Mannheim) and reaction buffer
according to the manufacturer's instructions: 200 .mu.M dNTP's;
0.01% v/v Triton X100; 10% v/v DMSO, and 0.2 pmol each of sense
and a-sense primer. The following reaction steps were performed:
35 cycles, 94.degree. C. 1 min, 64.degree. C. 1 min, 72.degree.
C. 2.5 min. MDA-MB-453 cDNA was used for the cloning of FGR-4.sup.388Arg,
and K562 cDNA for the cloning of FGFR-4wt. The PCR products were
cloned in the pcDNA3 vector (Invitrogen). In this way, both a FGFR-4
with the G388R and also a wild type FGFR-4 could be obtained for
further tests.
Amplification of the transmembrane domain of FGFR-4. The following
primers were used: sense-GACCGCAGCAGCGCCCGAGGCCAG [SEQ ID NO: 5];
anti-sense AGAGGGAAGAGGGAGAGCTTCTG [SEQ ID NO: 6]. For the PCR reaction,
the following were used: 1.5 U/25 .mu.l Taq-Polymerase (Boehringer,
Mannheim) and reaction buffer according to the manufacturer's instructions:
200 .mu.M dNTP's; 0.2 pmol each of sense and a-sense primer, 0.5
.mu.l cDNA or genomic DNA from tumour biopsies and cell lines; the
following reaction steps were performed: 35 cycles, 95.degree. C.
45 secs, 72.degree. C. 45 secs.
Analysis by restriction digestion. The transmembrane domain of
FGFR-4 from genomic or cDNA was amplified as described above. To
test biopsies and cell lines for the G1217A mutation by restriction
digestion, the PCR products were incubated for 1 hr at 60.degree.
C. with 5 U/25 .mu.l of BstN1 (NEB, Schwalbach/Taunus). The DNA
fragments from the restriction digestion were separated with a 20%
polyacrylamide gel and stained with ethidium bromide. The analysis
of the wild type receptor yields a 109, a 37 and a 22 base-pair
sized fragment (track 4). On the other hand, as a result of the
mutation G1217A a further restriction cleavage site for BstN1 is
formed. The mutated receptor shows further 80 and 29 base-pair sized
fragments, while the 109 base-pair sized fragment disappears (track
1: homozygotic; tracks 2 and 3: heterozygotic) (see FIG. 2).
Genotype analysis of genomic DNA by restriction digestion.
Genomic DNA from the tissue samples of the primary tumours was
isolated by standard methods (Current Protocols in Molecular Biology,
John Wiley and Sons, Inc., 1995). In order to be able to genotype
analyse the genomic DNA, the transmembrane region in the FGFR-4
gene was amplified with the following primers in a PCR reaction:
5'-GACCGCAGCAGCGCCCGAGGCCAG-3'(bp 1129-1142; [SEQ ID NO: 5]), and
5'-AGAGGGAAGAGGGAGAGCTTCTG-3'(bp 1275-1297; [SEQ ID NO: 61]). For
the PCR reaction, Ready-to-Go PCR Beats (Pharmacia, Uppsala, Sweden)
were used. The following PCR cycles were used: 3 min at 95.degree.
C., 45 secs at 94.degree. C., 45 secs at 72.degree. C. and 5 mins
at 72.degree. C. A total of 35 cycles were performed. The PCR products
were incubated for 1 hr at 60.degree. C. with 5 U/25 .mu.l of BstN1
(NEB, Schwalbach/Taunus). The DNA fragments from the restriction
digestion were separated with a 20% polyacrylamide gel and stained
with ethidium bromide. The .sup.388Arg allele is characterized by
two fragments of 80 and 29 bp size, while the .sup.388Arg allele
is indicated by a single 109 bp sized fragment. Each genotype analysis
was repeated three times.
DNA sequencing of PCR products. For the sequence analysis of the
transmembrane domain of FGFR-4, the PCR products were cloned into
the Bluescript vector. For this, a PCR reaction was performed as
already described. The following primers were used: sense-GGGAATTCGACCGCAGCAGCGCCCGAGG
[SEQ ID NO: 7]; .alpha.-sense-GCTCTAGAAGAGGGAAGAGGGAGAG [SEQ ID
NO: 8]. The PCR products of the cloning of FGFR-4 .sup.Arg388/wt
could be directly sequenced in the vector pcDNA3. The DNA sequencing
of plasmid DNA was performed by the chain termination method. After
annealing of the T/-primer onto the plasmid DNA, the sequencing
reaction was performed with T/-DNA polymerase (Pharmacia, Freiburg).
The products of the sequencing reaction were then separated on a
denaturing 5% polyacrylamide gel (7.5 M urea; 1.times.TBE) and exposed
on Xray film after drying (see FIG. 3). From this, the DNA sequences
of the wild type and also of the mutation, were obtained.
Immunoprecipitation and Western blot analysis. 2.2.times.106.sup.6
cells were spread onto 10 cm Petri dishes and incubated overnight.
Then the cell medium was replaced by medium with no foetal bovine
serum and incubated for a further 24 hrs. For the stimulation, the
cells were incubated for 10 mins with 50 ng aFGF/ml, washed twice
with cold PBS and placed on ice. The cells were incubated for 15
mins at 4.degree. C. with 300 .mu.l of cold lysis buffer (1% w/w
NP-40, 1.25% w/v sodium deoxycholate, 0.1% w/v SDS, 0.15 MNaCl,
0.01 M sodium phosphate, pH 7.2, 2 mM EDTA, 10 mM sodium fluoride,
1 mM PMSF, 20 .mu.g/ml aprotinin, 1 mM orthovanadate, 10 mM sodium
pyrophosphate), and the lysate clarified by centrifugation (13,000
RPM) at 4.degree. C. For the protein value determination, the Micro-BCA
Protein Assay (Pierce) was used in accordance with the manufacturer's
instructions. For the immunoprecipitation, the cell lysates were
adjusted to equal protein content and then incubated for 18 hrs
at 4.degree. C. with 0.5 .mu.g anti-FGFR-4 (Santa Cruz) and protein-A-Sepharose
(Pharmacia Freiburg) on a rotating wheel. The immune complexes were
washed 4 times with cold HNTG (20 mM HEPES pH 7.5, 150 mM NaCl,
0.1% Triton X100, 10% glycerine, 10 mM sodium pyrophosphate). For
sample preparation, the immune complexes were treated with 50 .mu.l
3 .times. Laemmli buffer and incubated for 5 mins at 99.degree.
C. The precipitated proteins were separated on a 7.5% SDS-PAGE (see
FIG. 1).
For Western blots, the proteins separated by SDS-PAGE were transferred
to nitrocellulose. Non-specific protein binding sites on the membrane
were blocked by incubation for 2 hrs at room temperature with TBS-T/0.25%
gelatine (10 mM Tris/HCl pH 8.0, 0.15 M NaCl, 0.05% Tween20). The
incubation with primary antibodies was effected for 6 hrs at 4.degree.
C. on a tilt shaker. Non-specifically bound antibodies were then
removed by washing 4 times with TBS-T/0.25% gelatine. The binding
of secondary antibodies was effected for 1 hr at room temperature.
The non-specifically bound secondary antibodies were removed by
a further washing step. Immune complexes were made visible with
the ECL.TM. kit (Amersham, Brunschweig) in accordance with the manufacturer's
instructions.
Statistical Methods. Statistical calculations were performed with
the aid of the statistics program MedCalc (MedCalc Software, Belgium)
and EpiInfo 6.04b (CDC, Atlanta, Ga.). In order to determine the
correlations between the genotypes in the different patient groups
and the clinical data, an odds ratio, the confidence interval (CI)
and a statistical significance (P value) were calculated. Because
of the small number of .sup.388Arg homozygotic patients, this group
as combined with the group of .sup.388Arg heterozygotic patients
for the statistical calculations.
Detection of FGFR-4 in Tumour Cell Lines. Table 1 shows the correlation
between the expression of RTK and breast cancer. Expression of RTK
clearly occurs more often in cell lines from breast cancer, while
no expression is detectable in cell lines of normal breast epithelial
cells.
TABLE-US-00001 TABLE 1 Detection of FGFR-4 in Breast Cancer Cells
Northern Blot [sic] FGFR-4 Breast Cancer Cell Lines 1 HTB-30 (SK-BR-3)
++ 2 HTB-122 (BT-549) - 3 MCF-7 + 4 BT-483 +++ 5 T-47D + 6 ZR-75-1
+++ 7 MDA-MB-468 - 8 MDA-MB-453 ++++ 9 MDA-MB-361 ++++ 10 MDA-MB-415
- 11 MDA-MB-231 - Normal Breast Epithelial Cell Lines 12 HBL-100
- 13 MCF-10A - Key: -: no expression +: expression ++: strong expression
+++: very strong expression ++++: extreme expression.
From Table 2, it is clear that the G388R mutation also occurs in
cell lines of other cancer types and is correlatable with these.
In healthy epithelial cell lines, the mutation is not detectable.
TABLE-US-00002 TABLE 2 Mutation FGFR-4 G388R in various other tumor
cell lines Sample genomic DNA cDNA Glioblastoma U-138 -/- -/- U-373
-/- -/- U-172 -/- -/- U-118 -/* -/* SF-763 -/- -/- U-1240 */* */*
T-98G (*)/- (*)/- U-937 -/- -/- Neuroblastoma SK-N-SH -/* -/* SH-SY-SY
-/* -/* Uterine Cancer OAW-42 -/* -/* PA-1 -/- -/- Caov-3 -/- -/-
Squamous Hlac-78 -/- -/- Hlac-79 -/- -/- Scc-4 -/- -/- Scc-10a -/-
-/- Scc-10b -/- -/- Scc-17a -/- -/- Scc-17b -/- -/- Scc-22a */*
*/* Scc-22b */* */* HaCat -/- -/- FaDu -/- -/- Normal Breast Epithelial
Cell Lines HBL-100 -/- -/- MCF-10A -/- -/- Key: -/- homozygotically
nonmutated */- heterozygotically mutated */* homozygotically mutated
Detection of the FGFR-4 Mutation G388R in Biopsies. Table 3 thus
shows that of 61 female patients from St Petersburg with breast
cancer who were studied, 56% carried the G388R mutation, 45% of
them heterozygotically and 11% homozygotically. Of the 69 female
breast cancer patients from Munich who were studied, 43% carried
the G388R mutation, 32% of them heterozygotically and 11% homozygotically.
The proportion of the total percentage of the mutation in female
patients from St Petersburg and Munich is different. This suggests
that the G388R mutation is a germ line mutation.
TABLE-US-00003 TABLE 3 Detection of FGFR-4 mutation G388R in biopsies
Samples from breast tumors From St Petersburg From Munich Sample
gen. DNA Sample gen. DNA cDNA 19 102 T */- 5382 T */- */- 20 102
N 5609T */* */* 21 103 T */- 8926 T */- */- 22 103 N */- 9456 T
*/* */* 23 2 T */* 9556 T */- */- 24 2 N */* 10347 T -/- -/- 25
12 T -/- 10555 T -/- -/- 26 12 N 10681 T */- */- 27 13 T -/- 10781
T */- */- 28 13 N 10808 T */* */* 29 14 T */- 11189 T */- */- 30
14 N */- 11526 T */- */- 31 15 T -/- 11697 T */- 32 15 N 11820 T
-/- -/- 33 17 T */- 12015 T -/- -/- 34 17 N */- 12166 T */- */-
35 18 T -/- 13932 T */- */- 36 18 N 16003 T */- */- 37 20 T -/-
16353 T -/- -/- 38 20 N 1 N 39 21 T */* 2 T */- */- 40 21 N */*
3 N 41 22 T */- 4 T -/- -/- 42 22 N 5 N 43 23 T */- 6 T -/- -/-
44 23 N 7 N 45 31 T */- 8 T -/- -/- 46 31 N */- 9 N 47 42 T -/-
10 T */- */- 48 42 N 11 N 49 43 T -/- 12 T -/- -/- 50 43 N 13 N
51 45 T -/- 14 T */- */- 52 45 N 16 T */- */- 53 47 T */- 17 N -/-
54 47 N */- 18 T */- 55 48 T -/- 19 N 56 48 N 20 T -/- 57 50 T -/-
38 T -/- 58 50 N 3433 T -/- 59 53 T -/- 3539 T 60 53 N 3631 T */*
61 54 T */- 3632 T -/- 62 54 N */- 3636 T -/- 63 55 T -/- 3637 T
*/- 64 55 N 3638 T -/- 65 60 T */- 3640 T -/- 66 60 N */- 991 N
-/- 67 61 T */* 991 T -/- 68 61 N */* 15153 N 69 62 T */- 15153
T -/- 70 62 N */- 15856 N */* 71 63 T */- 15856 T */* 72 63 N */-
12845 N 73 67 T */- 12845 T -/- 74 67 N */- 19044/93 N 75 69 T -/-
19044/93 T -/- 76 69 N 9426/93 N 77 78 T */- 9426/93 T -/- 78 78
N */- 2005 N */- 79 79 T */* 2005 T */- 80 79 N */* 14860 N 81 82
T -/- 14860 T -/- 82 82 N 4198 T -/- 83 83 T -/- 5739 T */* 84 83
N 6060/93 turn */* 85 85 T -/- 6982/93 turn -/- 86 85 N 7244/93
turn -/- 87 86 T */- 8114/93 turn -/- 88 86 N */- 8335/93 turn */-
89 87 T -/- 8481/93 turn */- 90 87 N 8566/93 turn -/- 91 89 T -/-
8786/93 turn */* 92 89 N 9145/93 turn -/- 93 94 T -/- 9354/93 turn
-/- 94 94 N 9796/93 turn -/- 95 97 T */* 9798/93 turn -/- 96 97
N */- 10125/93 turn -/- 97 98 T -/- 10150/93 turn */- 98 98 N 11218/93
turn -/- 99 99 T */* 11673/93 turn -/- 100 99 N */* 13232/93 turn
-/- 101 100 T -/- 13316/93 turn */- 102 100 N 14724/93 tum -/- 103
101 T */- 14879/93 tum #1 -/- 104 101 N */- 14879/93 tum #2 -/-
105 102 T (#20) */- 15645/93 tum -/- 106 102 N (#19) */* 107 103
T (#22) */- 108 103 N (#21) 109 104 T */- 110 92 T */* 111 65 T
112 52 T */- 113 35 T */- 114 33 "A" T */- 115 33 "B"
mts. */- 116 30 T */- 134 30 N */- 117 27 T */* 133 27 N */* 118
24 T */- 119 10 T */- 132 10 T */- 120 3 T -/- 121 90 T -/- 122
90 N 123 80 T -/- 124 80 N 125 81 T -/- 126 58 T -/- 127 51 T */-
128 51 N 129 44 T */- 130 44 N
Correlation between the FGFR-4-G388R mutation and the detection
of FGFR-4 expression. From Table 4 below, it is clear that the G388R
mutation (genomic DNA and cDNA) only occurs when expression and/or
intensified expression occurs. The mutation is detectable neither
in the normal breast epithelial cell lines nor in the breast cancer
cell lines in which no RTK expression was found.
The cell line MDA-MB 453, whose RTK expression is especially pronounced,
shows a homozygotic G388R mutation.
TABLE-US-00004 TABLE 4 Correlation between the FGFR-4-G388R mutation
and the detection of FGFR-4 expression Northern Blot Mutation FGFR-4
cDNA gen. DNA Breast cancer cell line 1 HTB-30 (SK-BR-3) ++ +/+
+/+ 2 HTB-122 (BT-549) - -/- -/- 3 MCF-7 + +/- +/- 4 BT-483 +++
+/- +/- 5 T-47D + +/- +/- 6 ZR-75-1 +++ +/- +/- 7 MDA-MB-468 - -/-
-/- 8 MDA-MB-453 ++++ +/+ +/+ 9 MDA-MB-361 ++++ +/- +/- 10 MDA-MB-415
- -/- -/- 11 MDA-MB-231 - +/- +/- Normal Breast Epithelial Cell
Lines 12 HBL-100 - -/- -/- 13 MCF-10A - -/- -/- Key: -: no expression
+: expression ++: strong expression +++: very strong expression
++++: extreme expression. -/-: no mutation */-: heterozygotically
mutated */*: homozygotically mutated
Study of the Correlation Between the Occurrence of the FGFR-4 Mutation
G388R and Lymph Node Metastasis Status or Relapse-Free Survival
Time
Table 5 shows the clinical parameters of all patients who took
part in the study of the role of the G388R mutation in the tumorigenesis
of breast cancer. It is found that patients with a G388R mutation
have a worse long-term prognosis than patients with no G388R mutation.
Key to Table 5: [on following pages]
Her2: expression level of the Her2 receptor; 0=no expression to
3=overexpression
OPDAT: date of the operation
M/R: metastasis formation/relapse; 0=no/1=yes
Vers: died; 0=no/1=yes
UBERRE: survival time without relapse, in months
Grade: differentiation grade of tumour; 1=strong differentiation/3=low
differentiation
stage: size of the primary tumour.
E-Rec: expression of the oestrogen receptor; 0=no expression to
12=highest expression
GEN: genotype of the FGFR-4; G=wild type allele; R=mutated allele
BEDAT: date of last observation
REZDAT: date of relapse diagnosis
TODDAT: date of death
UBERLEB: survival time overall
Nod.: metastases in the lymph nodes; 0=no/1=yes
Men: menopause
P-Rec: expression of the progesterone receptor: 0=no expression
to 12=highest expression
TABLE-US-00005 TABLE 5 FGFR-4 genotypes and clinical case data
PathoNr. Her2 GEN OPDAT BEDAT M/R REZDAT Vers TODDAT 489292 G/G
31.03.92 14.02.97 0 0 617792 G/G 24.04.92 14.07.94 0 0 639792 0
G/G 29.04.92 03.04.94 0 0 724493 G/G 11.05.93 23.06.97 0 0 914593
0 G/G 16.06.93 07.03.96 0 0 935493 2+ G/G 21.06.93 15.03.96 0 0
963392 G/G 30.06.92 30.06.97 0 0 979693 G/G 29.06.93 07.03.96 0
0 979893 1+ G/G 29.06.93 30.06.97 0 0 1034792 0 G/G 13/07.92 26.03.97
0 0 1323293 G/G 02.03.93 05.08.97 0 0 1331693 3+ G/G 30.09.92 29.03.95
0 0 1564593 1+ G/G 19.10.92 19.06.97 0 0 78692 G/G 19.01.88 29.06.93
0 0 176989 3+ G/G 08.02.85 06.02.92 0 0 273690 1+ G/G 22.02.86 14.02.92
0 0 725289 G/G 14.12.87 0 729991 0 G/G 23.05.87 22.02.92 0 0 733290
1+ G/G 28.05.86 28.03.87 0 1 28.03.87 826790 2+ G/G 19.06.86 22.01.94
0 0 867191 0 G/G 19.06.87 22.01.94 0 0 988590 G/G 24.07.86 22.01.94
0 0 991790 0 G/G 23.07.86 25.03.92 0 0 1031190 2+ G/G 30.07.86 26.01.94
0 0 1033391 1+ G/G 21.07.87 03.03.92 0 0 1055592 G/G 14.07.88 25.04.93
0 1 25.04.93 1101191 0 G/G 31.07.87 03.06.93 0 0 1426491 1+ G/G
08.10.87 04.02.94 0 0 1560492 G/G 22.09.88 02.04.92 0 0 1605790
0 G/G 25.11.86 20.02.92 0 0 1641488 2+ G/G 21.12.84 04.02.94 0 0
1121893 1+ G/G 23.07.93 18.01.96 1 06.09.94 1 18.01.96 1201592 1+
G/G 10.08.92 25.04.95 1 25.04.95 0 258093 0 G/G 22.02.85 18.04.91
1 30.11.89 1 18.04.91 479090 3+ G/G 04.04.86 23.07.89 1 12.04.88
1 23.07.89 806490 0 G/G 14.06.86 18.09.90 1 10.11.88 1 18.09.90
963589 1+ G/G 26.07.85 06.03.89 1 26.04.88 1 06.03.89 972291 3+
G/G 09.07.87 19.08.89 1 16.07.88 1 19.08.89 995589 0 G/G 01.08.85
27.06.88 1 29.04.87 1 27.06.88 1112389 3+ G/G 30.08.85 14.07.86
1 14.06.86 1 14.07.86 1723892 G/G 18.11.88 23.04.91 1 07.11.90 1
23.04.91 289791 3+ G/R 25.02.87 02.04.92 0 0 337293 G/R 03.03.89
04.03.92 0 0 879290 2+ G/R 01.07.86 01.10.92 0 1 01.10.92 893090
0 G/R 03.07.86 17.12.93 0 0 1106192 G/R 23.07.88 04.02.94 0 0 1107789
G/R 29.08.85 13.02.92 0 0 1113892 G/R 24.07.92 14.10.97 0 0 1118990
G/R 19.08.86 15.02.92 0 0 1152692 3+ G/R 31.07.92 30.06.97 0 0 1599789
1+ G/R 14.12.85 15.02.87 0 1 15.02.87 1614591 0 G/R 12.11.87 25.02.92
0 0 92390 0 G/R 20.01.86 13.02.92 1 09.02.91 0 99289 0 G/R 23.01.85
17.03.92 1 22.02.90 0 130588 2+ G/R 20.01.84 30.01.92 1 18.02.87
0 306490 3+ G/R 01.03.86 06.06.87 1 06.11.86 1 06.06.87 492191 3+
G/R 07.04.87 20.04.94 1 10.10.90 0 529692 G/R 07.04.92 29.03.96
1 23.02.95 1 29.03.96 529990 3+ G/R 17.04.86 29.04.87 1 14.04.87
1 29.04.87 538292 3+ G/R 07.04.92 13.10.93 1 07.04.92 1 13.10.93
614091 2+ G/R 29.04.87 21.04.90 1 31.07.88 1 21.04.90 651591 0 G/R
07.05.87 17.09.93 1 14.04.90 0 673592 G/R 06.05.92 27.02.96 1 06.06.93
0 678092 2+ G/R 07.05.92 29.06.96 1 07.05.92 0 714289 2+ G/R 04.06.85
16.09.89 1 30.06.87 1 16.09.89 807492 0 G/R 29.05.92 29.11.96 1
29.11.96 0 848193 G/R 03.06.93 10.09.94 1 16.08.94 1 10.09.94 955692
1+ G/R 29.06.92 26.11.96 1 17.08.95 37 1022090 0 G/R 29.07.86 02.07.88
1 23.06.88 1 02.07.88 1054987 G/R 05.08.83 15.12.84 1 29.02.84 1
15.12.84 1078192 2+ G/R 20.07.92 22.10.95 1 25.09.95 0 1079689 2+
G/R 22.08.85 27.03.91 1 31.12.89 1 27.03.91 1169792 2+ G/R 04.08.92
01.07.95 1 01.07.95 1 01.07.95 1216692 0 G/R 12.08.92 30.07.96 1
09.09.94 0 1314689 2+ G/R 16.10.85 21.02.92 1 05.11.91 0 1391992
2+ G/R 17.09.92 01.05.93 1 15.01.93 1 01.05.93 1696290 G/R 11.12.86
20.02.92 1 30.11.89 0 920891 G/R 213593 R/R 10.02.89 20.04.94 0
0 313791 3+ R/R 28.02.87 21.02.92 0 0 878693 R/R 09.06.93 07.09.96
0 0 1107391 3+ R/R 01.08.87 29.02.92 0 0 1125690 R/R 20.08.86 13.10.93
0 0 120788 R/R 27.01.84 24.04.86 1 28.01.86 1 24.04.86 560992 3+
R/R 13.04.92 04.04.93 1 10.04.92 1 4.4.93 1008692 2+ R/R 08.07.92
11.07.94 1 17.08.93 1 11.07.94 1686490 3+ R/R 10.12.86 23.07.87
1 07.05.87 1 23.07.87 PathoNr. UBERRE Uberleb Age slage Nod. Grade
Men E-Rec P-Rec 489292 59 59 71.7 1c 0 2 2 12 9 617792 27 27 1 639792
23 23 0 724493 48 48 64.3 2 1 2 2 12 12 914593 33 33 86.2 2 2 2
8 9 935493 33 33 49.6 2 1 3 2 0 0 963392 60 60 79.4 1b 0 2 2 3 12
979693 33 33 46.7 2 0 2 3 9 0 979893 48 48 77 4b 1 2 2 1 0 1034792
56 56 43.5 3 1 2 1 0 6 1323293 48 48 61.4 2 1 3 2 0 0 1331693 36
36 71.2 2 1 2 2 6 1 1564593 56 56 65.3 2 1 2 2 0 0 78692 65 65 63.8
2 0 3 2 4 12 176989 84 84 43.4 2 1 2 1 273690 72 72 52.3 2 0 2 1
12 12 725289 49.5 2 0 2 0 0 729991 57 57 65.7 2 1 2 2 12 12 733290
14 14 81.7 1b 0 2 2 12 12 826790 91 91 77.7 2 0 2 2 9 0 867191 79
79 77.5 2 0 3 2 0 0 988590 90 90 61.5 1b 0 2 2 6 9 991790 68 68
50.7 1c 0 2 2 8 4 1031190 90 90 43.4 1c 0 2 1 1033391 55 55 62.4
2 1 3 2 12 12 1055592 57 79 77.8 2 0 2 2 6 12 1101191 70 70 48.5
2 0 2 1 0 0 1426491 76 76 54.9 1b 0 3 2 0 0 1560492 42 42 50 1c
0 3 3 0 0 1605790 63 63 56.4 1c 1 2 2 12 6 1641488 109 109 67.4
1b 0 2 2 9 1121893 14 16 59.9 2 1 3 2 4 2 1201592 29 29 48.9 1c
1 2 1 1 6 258093 57 102 79.4 1c 1 2 2 479090 24 55 67.9 1c 0 2 2
0 0 806490 29 71 66.7 2 1 2 2 8 0 963589 33 60 47.8 2 1 3 1 0 972291
12 35 48.3 2 0 3 1 0 0 995589 21 48 58.4 3 1 3 2 6 1112389 9 14
79.4 4b 2 2 2 0 0 1723892 24 40 38.7 2 0 3 1 0 0 289791 61 61 48.1
2 1 3 2 0 0 337293 36 36 51.2 1c 0 2 1 6 2 879290 75 103 44.9 1c
0 3 1 1 6 893090 89 89 68.5 4 0 3 2 12 6 1106192 66 66 53.9 1c 0
2 2 2 12 1107789 77 77 50.3 1c 0 2 1 8 12 1113892 63 63 51.9 2 0
1 2 2 6 1118990 66 66 53.8 1c 0 2 2 6 4 1152692 59 59 57.7 2 1 2
2 4 12 1599789 14 19 80.2 1c 0 3 2 3 2 1614591 51 51 76.7 2 1 2
2 3 9 92390 61 73 45.8 2 1 3 1 0 1 99289 61 86 47.1 1c 1 2 1 130588
37 96 39 2 1 2 1 306490 8 21 52.2 2 1 3 3 0 0 492191 42 84 56.2
2 1 3 2 3 0 529692 34 46 66.9 1b 0 3 2 0 0 529990 12 17 77.1 2 1
3 2 0 0 538292 0 18 56.1 4 2 3 2 0 0 614091 15 49 47.2 2 2 2 1 2
6 651591 35 76 49.3 3 1 2 1 3 9 673592 13 45 36.8 2 0 2 1 0 0 678092
0 49 56.7 1c 1 2 2 0 0 714289 25 71 55 1c 1 2 2 8 807492 54 54 1
848193 15 16 58 2 2 2 2 0 4 955692 53 49.9 1c 1 3 3 2 1 1022090
23 32 51.7 2 2 2 2 12 1 1054987 7 23 71.5 2 0 3 2 1078192 38 39
79.4 2 1 3 2 1 9 1079689 52 93 81.4 4 2 3 2 1169792 47 47 67.3 2
1 3 2 6 9 1216692 23 48 45.3 2 1 2 1 4 6 1314689 73 76 81.2 4 1
2 2 6 12 1391992 5 8 76 2 1 3 2 1696290 36 62 55.2 2 0 2 2 6 6 920891
50.5 2 0 3 1 2 6 213593 62 62 45.3 1c 0 2 1 3 6 313791 60 60 68.6
2 1 3 2 0 0 878693 33 33 0 1107391 55 55 61.5 1c 0 2 2 3 1 1125690
86 86 43.1 3 1 3 1 0 0 120788 24 37 68.1 2 1 3 2 560992 0 12 59.1
4b 2 3 2 6 0 1008692 13 24 47.4 2 1 3 2 0 0 1686490 5 10 55.4 2
1 3 2 0 0
From FIG. 4, it is clear that the G388R mutation is to be found
in greater number in patients who already have metastases in the
lymph nodes at the time of the first treatment. Of the patients
with a G388R mutation, 62.7% had lymph node metastases, while of
the patients with no G388R mutation only 38.2% displayed metastases
in the lymph nodes. As the lymph node metastasis status is an important
prognostic marker for the further discrimination of tumours with
a worse and those with a better prognosis, it can be concluded from
this result that the G388R mutation in the 85 patients studied leads
to a more severe tumour progression.
From FIG. 5 it is can be seen that in the group of patients studied,
the relapse-free survival probability is very much lower for those
with a G388R mutation than for those patients who have no G388R
mutation. While 74.4% or the patients with a relapse possess the
388R genotype, only 25.6% have the 388G genotype. This shows that
patients with the G388R mutation suffer a relapse more quickly,
and therefore could not be successfully treated.
In summary, it can be stated that the FGFR-4 mutation G388R leads
to a 2.7-fold (OR=2.7; CI: 1.02<OR<7.4) increased risk of
metastasis formation in the lymph nodes and to a 5.44-fold (OR=5.44;
CI: 1.93<OR<7.4) increased risk of a tumour relapse. Patients
with a mutated FGFR-4 allele (G388R) thus seem to have a predisposition
to a tumour relapse and hence a poorer disease prognosis.
TABLE-US-00006 Materials Acrylamide Serva, Heidelberg Agar Difco,
Detroit Agarose BRL, Eggenstein Ampicillin Boehringer, Mannheim
Aprotinin Sigma, Taufkirchen N,N'-bisacrylamide Roth, Karlsruhe
Caesium chloride BRL, Eggenstein Desoxynucleotides Pharmacia, Freiburg
Ethidium bromide Sigma, Taufkirchen Gelatine Sigma, Taufkirchen
Guanidium isothiocyanate Fluka, Switzerland HEPES Serva, Heidelberg
Sodium fluoride Sigma, Taufkirchen PMSF Sigma, Taufkirchen SDS Roth,
Karlsruhe Tris Riedel de Haen, Seelze Triton X100 Serva, Heidelberg
Tween20 Sigma, Taufkirchen
All substances not listed here came from the firms Sigma (Taufkirchen),
Serva (Heidelberg), Riedel De Haen or Merck (Darmstadt) and the
highest possible purity grades were used.
TABLE-US-00007 Instruments Electrophoresis of DNA Workshop, MPI
for Biochemistry, Martinsried Electrophoresis of proteins Atto,
Japan Refrigerated centrifuge Biofuge 17S Heraeus, Hanau Protein
transfer Semidry blot apparatus, Workshop, MPI for Biochemistry,
Martinsried Sterile workbench Biogard, The Baker Company, USA Cell
culture Incubator B5060 EK/CO.sub.2, Heraeus, Hanau Cell counting
Coulter Counter, Coulter Electronics, Glasgow.
LITERATURE
Basilico C and Moscatelli D: The FGF family of growth factors and
oncogenes. Advanc. Cancer Res. 59, 115-164 (1992). Coulier F, De
Lapeyriere O and Bimnbaulm D: Complexity of the FGF family: the
proof by 9. Med./Sci. 9, 1113-1115 (1993). Folkmann J and Klagsbrun
M: Science 235, 442-447 (1987). Gizal D and Yayon A: Complexity
of FGF receptors: genetic basis for structural diversity and functional
specificity, FASEB J. 6: 3362-3369 (1992). Johnson D E and Williams
L T: Structural and functional diversity in the FGF receptor multigene
family. Adv. Cancer Res. 60: 1-41 (1993). Kimelman D, Abraham J
A, Haaparanta T, Palisi T M and Kirschner M W: Science, 242, 1053-1058
(1988). Mohammadi M et al., Science 776, 955-959 (1997). Slack J
M W, Darlington G G, Heath J K and Godsave S F: Nature 326, 197-200
(1987). Thomas K A, Rios-Candelore M, Giminez-Gallego G, DiSalvo
J, Bennett C, Rodkey J and Fitzpatrick S: Proc. Natl. Acad. Sci;
USA, 82, 6409-6413 (1985). Thompson J A, Haudenschild C C, Anderson
K D, DiPietro J M, Anderson W F and Maciag T. (1989): Proc. Natl.
Acad. Sci. USA, 86, 7928-7932 (1989).
TABLE-US-00008 Cell Line Origin No. U-138 ATTC HTB-16 U-373 ATTC
HTB-17 U-172 U-118 ATTC HTB-15 SF-763 SUGEN U-1240 SUGEN T-98G SUGEN
U-937 ATCC CRL-1593 SK-N-SH ATCC HTB-11 SH-SY5Y F. J. Klinz OAW-42
DKFZ PA-1 ATCC CRL-1572 Caov-3 ATCC HTB-75 Hlac-78 Dr. Wustrow Hlac-79
Dr. Wustrow Scc-4 ATCC CRL-1624 Scc10a Dr. Wustrow Scc10b Dr. Wustrow
Scc22a Dr. Wustrow Scc22b Dr. Wustrow Scc17a Dr. Wustrow Scc17b
Dr. Wustrow FaDu Dr. Wustrow HaCat HBL100 ATCC HTB-124 MCF10A ATCC
CRL-10317 SKBr-3 ATCC HTB-30 BT-549 ATCC HTB-122 MCF-7 ATCC HTB-22
BT483 ATCC HTB-121 T-47-D ATCC HTB-133 ZR-75-1 ATCC CRL-1500 MDA-MB-468
ATCC HTB-132 MDA-MB-453 ATCC HTB-131 MDA-MB-361 ATCC HTB-27 MDA-MB-415
ATCC HTB-128 MDA-MB-231 ATCC HTB-26 K-562 ATCC CCL-243
>
8 T Homo sapiens DOMAIN () amino acid sequence of FGFR-4 (mutant)
between positions 366-39 Tyr Thr Asp Ile Ile Leu Tyr Ala Ser Gly
Ser Leu Ala Leu Ala Leu Leu Leu Leu Ala Arg Leu Tyr 225 PRT Homo
sapiens DOMAIN () amino acid sequence of FGFR-4 (wild-type) between
positions 366-39 Tyr Thr Asp Ile Ile Leu Tyr Ala Ser Gly Ser Leu
Ala Leu Ala Leu Leu Leu Leu Ala Gly Leu Tyr 229 DNA artificial sequence
PCR primer for the amplification of FGFR-4 (wild-type and mutant)
3 gctcagaggg cgggcggggg tgccggccg 29 4 33 DNA artificial sequence
PCR primer for the amplification of FGFR-4 (wild-type and mutant)
4 ccgctcgagt gcctgcacag ccttgagcct tgc 33 5 24 DNA artificial sequence
PCR primer for the amplification of the transmembrane domain of
FGFR-4 (wild-type and mutant) 5 gaccgcagca gcgcccgagg ccag 24 6
23 DNA artificial sequence PCR primer for the amplification of the
transmembrane domain of FGFR-4 (wild-type and mutant) 6 agagggaaga
gggagagctt ctg 23 7 28 DNA artificial sequence primer for sequencing
of the transmembrane domain of FGFR-4 (wild-type and mutant) 7 gggaattcga
ccgcagcagc gcccgagg 28 8 25 DNA artificial sequence primer for sequencing
of the transmembrane domain of FGFR-4 (wild-type and mutant) 8 gctctagaag
agggaagagg gagag 25
|